**************************************************************************** Note: By default, each nucleotide is identified by chainId.name#. So a common case would be B.A1689, meaning adenosine #1689 on chain B. One-letter base names for modified nucleotides are put in lower case (e.g., 'c' for 5MC). For further information about the output notation, please refer to the DSSR User Manual. Questions and suggestions are *always* welcome on the 3DNA Forum. Command: x3dna-dssr -i=5ccw.pdb -o=5ccw.out File name: 5ccw.pdb no. of DNA/RNA chains: 1 [A=21] no. of nucleotides: 21 no. of atoms: 543 no. of waters: 22 no. of metals: 5 [K=2,Au=3] **************************************************************************** List of 12 base pairs nt1 nt2 bp name Saenger LW DSSR 1 A.DG3 A.DG9 G+G -- 06-VI cWH cW+M 2 A.DG3 A.DG21 G+G -- 06-VI cHW cM+W 3 A.DG4 A.DG10 G+G -- 06-VI cWH cW+M 4 A.DG4 A.DG22 G+G -- 06-VI cHW cM+W 5 A.DG5 A.DG11 G+G -- 06-VI cWH cW+M 6 A.DG5 A.DG23 G+G -- 06-VI cHW cM+W 7 A.DG9 A.DG15 G+G -- 06-VI cWH cW+M 8 A.DG10 A.DG16 G+G -- 06-VI cWH cW+M 9 A.DG11 A.DG17 G+G -- 06-VI cWH cW+M 10 A.DG15 A.DG21 G+G -- 06-VI cWH cW+M 11 A.DG16 A.DG22 G+G -- 06-VI cWH cW+M 12 A.DG17 A.DG23 G+G -- 06-VI cWH cW+M **************************************************************************** List of 3 multiplets 1 nts=4 GGGG A.DG3,A.DG9,A.DG15,A.DG21 2 nts=4 GGGG A.DG4,A.DG10,A.DG16,A.DG22 3 nts=4 GGGG A.DG5,A.DG11,A.DG17,A.DG23 **************************************************************************** List of 2 helices Note: a helix is defined by base-stacking interactions, regardless of bp type and backbone connectivity, and may contain more than one stem. helix#number[stems-contained] bps=number-of-base-pairs in the helix bp-type: '|' for a canonical WC/wobble pair, '.' otherwise helix-form: classification of a dinucleotide step comprising the bp above the given designation and the bp that follows it. Types include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices, '.' for an unclassified step, and 'x' for a step without a continuous backbone. -------------------------------------------------------------------- helix#1[0] bps=3 parallel strand-1 5'-GGG-3' bp-type ... strand-2 5'-GGG-3' helix-form .. 1 A.DG3 A.DG9 G+G -- 06-VI cWH cW+M 2 A.DG4 A.DG10 G+G -- 06-VI cWH cW+M 3 A.DG5 A.DG11 G+G -- 06-VI cWH cW+M -------------------------------------------------------------------------- helix#2[0] bps=3 parallel strand-1 5'-GGG-3' bp-type ... strand-2 5'-GGG-3' helix-form .. 1 A.DG15 A.DG21 G+G -- 06-VI cWH cW+M 2 A.DG16 A.DG22 G+G -- 06-VI cWH cW+M 3 A.DG17 A.DG23 G+G -- 06-VI cWH cW+M **************************************************************************** List of 4 base stacks Note: a stack is an ordered list of nucleotides assembled together via base-stacking interactions, regardless of backbone connectivity. Stacking interactions within a stem are *not* included. 1 nts=3 GGG A.DG3,A.DG4,A.DG5 2 nts=3 GGG A.DG9,A.DG10,A.DG11 3 nts=3 GGG A.DG15,A.DG16,A.DG17 4 nts=3 GGG A.DG21,A.DG22,A.DG23 **************************************************************************** Nucleotides not involved in stacking interactions nts=7 ATTATTA A.DA2,A.DT6,A.DT7,A.DA8,A.DT18,A.DT19,A.DA20 **************************************************************************** List of 12 atom-base capping interactions dv: vertical distance of the atom above the nucleotide base ----------------------------------------------------------- type atom nt dv 1 other N2@A.51O105 A.DG3 3.29 2 other N1@A.51O105 A.DG3 3.37 3 other N4@A.51O105 A.DG3 3.43 4 other N4@A.51O103 A.DG5 3.40 5 other N3@A.51O103 A.DG5 3.19 6 other N5@A.51O105 A.DG9 3.37 7 other N6@A.51O103 A.DG11 3.38 8 other AU@A.51O103 A.DG11 3.45 9 other N6@A.51O104 A.DG15 3.40 10 other AU@A.51O104 A.DG15 3.27 11 other N3@A.51O104 A.DG21 3.48 12 other O1@A.51O104 A.DG21 3.27 **************************************************************************** List of 1 non-loop single-stranded segment 1 nts=21* TAGGGTTAGGGTGGGTTAGGG A.DT1,A.DA2,A.DG3,A.DG4,A.DG5,A.DT6,A.DT7,A.DA8,A.DG9,A.DG10,A.DG11,A.DT12,A.DG15,A.DG16,A.DG17,A.DT18,A.DT19,A.DA20,A.DG21,A.DG22,A.DG23 **************************************************************************** List of 3 G-tetrads 1 glyco-bond=---- sugar=.--- groove=---- planarity=0.225 type=bowl-2 nts=4 GGGG A.DG3,A.DG9,A.DG15,A.DG21 2 glyco-bond=---- sugar=---- groove=---- planarity=0.223 type=bowl-2 nts=4 GGGG A.DG4,A.DG10,A.DG16,A.DG22 3 glyco-bond=---- sugar=---- groove=---- planarity=0.313 type=bowl nts=4 GGGG A.DG5,A.DG11,A.DG17,A.DG23 **************************************************************************** List of 5 splayed-apart dinucleotides 1 A.DA2 A.DG3 angle=133 distance=18.0 ratio=0.92 2 A.DG5 A.DT6 angle=171 distance=18.7 ratio=1.00 3 A.DT7 A.DA8 angle=164 distance=19.8 ratio=0.99 4 A.DG17 A.DT18 angle=164 distance=19.1 ratio=0.99 5 A.DT19 A.DA20 angle=147 distance=18.7 ratio=0.96 ---------------------------------------------------------------- Summary of 5 splayed-apart units 1 nts=2 AG A.DA2,A.DG3 2 nts=2 GT A.DG5,A.DT6 3 nts=2 TA A.DT7,A.DA8 4 nts=2 GT A.DG17,A.DT18 5 nts=2 TA A.DT19,A.DA20 **************************************************************************** Secondary structures in dot-bracket notation (dbn) as a whole and per chain >5ccw nts=21 [whole] TAGGGTTAGGGT&GGGTTAGGG ............&......... >5ccw-A #1 nts=21 0.55(3.98) [chain] DNA* TAGGGTTAGGGT&GGGTTAGGG ............&......... **************************************************************************** Summary of structural features of 21 nucleotides Note: the first five columns are: (1) serial number, (2) one-letter shorthand name, (3) dbn, (4) id string, (5) rmsd (~zero) of base ring atoms fitted against those in a standard base reference frame. The sixth (last) column contains a comma-separated list of features whose meanings are mostly self-explanatory, except for: turn: angle C1'(i-1)--C1'(i)--C1'(i+1) < 90 degrees break: no backbone linkage between O3'(i-1) and P(i) 1 T . A.DT1 --- non-stack,ss-non-loop 2 A . A.DA2 0.002 syn,non-stack,ss-non-loop,splayed-apart 3 G . A.DG3 0.009 anti,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad,cap-acceptor,splayed-apart 4 G . A.DG4 0.004 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad 5 G . A.DG5 0.007 anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad,cap-acceptor,splayed-apart 6 T . A.DT6 0.002 anti,~C2'-endo,non-stack,ss-non-loop,splayed-apart 7 T . A.DT7 0.003 anti,~C2'-endo,non-stack,ss-non-loop,splayed-apart 8 A . A.DA8 0.006 anti,~C2'-endo,non-stack,ss-non-loop,splayed-apart 9 G . A.DG9 0.005 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad,cap-acceptor 10 G . A.DG10 0.008 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad 11 G . A.DG11 0.009 anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad,cap-acceptor 12 T . A.DT12 --- break,~C2'-endo,non-stack,ss-non-loop 13 G . A.DG15 0.006 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad,cap-acceptor 14 G . A.DG16 0.008 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad 15 G . A.DG17 0.004 anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad,splayed-apart 16 T . A.DT18 0.002 anti,~C2'-endo,non-stack,ss-non-loop,splayed-apart 17 T . A.DT19 0.002 syn,~C2'-endo,non-stack,ss-non-loop,splayed-apart 18 A . A.DA20 0.006 anti,~C2'-endo,non-stack,ss-non-loop,splayed-apart 19 G . A.DG21 0.010 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad,cap-acceptor 20 G . A.DG22 0.010 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,G-tetrad 21 G . A.DG23 0.007 anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,G-tetrad **************************************************************************** List of 10 additional files 1 dssr-pairs.pdb -- an ensemble of base pairs 2 dssr-multiplets.pdb -- an ensemble of multiplets 3 dssr-helices.pdb -- an ensemble of helices (coaxial stacking) 4 dssr-2ndstrs.bpseq -- secondary structure in bpseq format 5 dssr-2ndstrs.ct -- secondary structure in connectivity table format 6 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation 7 dssr-torsions.txt -- backbone torsion angles and suite names 8 dssr-splays.pdb -- an ensemble of splayed-apart units 9 dssr-stacks.pdb -- an ensemble of base stacks 10 dssr-atom2bases.pdb -- an ensemble of atom-base stacking interactions