**************************************************************************** Note: By default, each nucleotide is identified by chainId.name#. So a common case would be B.A1689, meaning adenosine #1689 on chain B. One-letter base names for modified nucleotides are put in lower case (e.g., 'c' for 5MC). For further information about the output notation, please refer to the DSSR User Manual. Questions and suggestions are *always* welcome on the 3DNA Forum. Command: x3dna-dssr -i=3mxb.pdb -o=3mxb.out File name: 3mxb.pdb no. of DNA/RNA chains: 4 [C=24,E=24,T=24,V=24] no. of nucleotides: 96 no. of atoms: 7005 no. of waters: 179 no. of metals: 4 [Ca=4] **************************************************************************** List of 48 base pairs nt1 nt2 bp name Saenger LW DSSR 1 C.DT501 E.DA624 T-A WC 20-XX cWW cW-W 2 C.DT502 E.DA623 T-A WC 20-XX cWW cW-W 3 C.DG503 E.DC622 G-C WC 19-XIX cWW cW-W 4 C.DT504 E.DA621 T-A WC 20-XX cWW cW-W 5 C.DT505 E.DA620 T-A WC 20-XX cWW cW-W 6 C.DC506 E.DG619 C-G WC 19-XIX cWW cW-W 7 C.DT507 E.DA618 T-A WC 20-XX cWW cW-W 8 C.DC508 E.DG617 C-G WC 19-XIX cWW cW-W 9 C.DA509 E.DT616 A-T WC 20-XX cWW cW-W 10 C.DG510 E.DC615 G-C WC 19-XIX cWW cW-W 11 C.DG511 E.DC614 G-C WC 19-XIX cWW cW-W 12 C.DT512 E.DA613 T-A WC 20-XX cWW cW-W 13 C.DA513 E.DT612 A-T WC 20-XX cWW cW-W 14 C.DC514 E.DG611 C-G WC 19-XIX cWW cW-W 15 C.DC515 E.DG610 C-G WC 19-XIX cWW cW-W 16 C.DT516 E.DA609 T-A WC 20-XX cWW cW-W 17 C.DC517 E.DG608 C-G WC 19-XIX cWW cW-W 18 C.DA518 E.DT607 A-T WC 20-XX cWW cW-W 19 C.DG519 E.DC606 G-C WC 19-XIX cWW cW-W 20 C.DC520 E.DG605 C-G WC 19-XIX cWW cW-W 21 C.DC521 E.DG604 C-G WC 19-XIX cWW cW-W 22 C.DA522 E.DT603 A-T WC 20-XX cWW cW-W 23 C.DG523 E.DC602 G-C WC 19-XIX cWW cW-W 24 C.DA524 E.DT601 A-T WC 20-XX cWW cW-W 25 T.DT501 V.DA624 T-A WC 20-XX cWW cW-W 26 T.DT502 V.DA623 T-A WC 20-XX cWW cW-W 27 T.DG503 V.DC622 G-C WC 19-XIX cWW cW-W 28 T.DT504 V.DA621 T-A WC 20-XX cWW cW-W 29 T.DT505 V.DA620 T-A WC 20-XX cWW cW-W 30 T.DC506 V.DG619 C-G WC 19-XIX cWW cW-W 31 T.DT507 V.DA618 T-A WC 20-XX cWW cW-W 32 T.DC508 V.DG617 C-G WC 19-XIX cWW cW-W 33 T.DA509 V.DT616 A-T WC 20-XX cWW cW-W 34 T.DG510 V.DC615 G-C WC 19-XIX cWW cW-W 35 T.DG511 V.DC614 G-C WC 19-XIX cWW cW-W 36 T.DT512 V.DA613 T-A WC 20-XX cWW cW-W 37 T.DA513 V.DT612 A-T WC 20-XX cWW cW-W 38 T.DC514 V.DG611 C-G WC 19-XIX cWW cW-W 39 T.DC515 V.DG610 C-G WC 19-XIX cWW cW-W 40 T.DT516 V.DA609 T-A WC 20-XX cWW cW-W 41 T.DC517 V.DG608 C-G WC 19-XIX cWW cW-W 42 T.DA518 V.DT607 A-T WC 20-XX cWW cW-W 43 T.DG519 V.DC606 G-C WC 19-XIX cWW cW-W 44 T.DC520 V.DG605 C-G WC 19-XIX cWW cW-W 45 T.DC521 V.DG604 C-G WC 19-XIX cWW cW-W 46 T.DA522 V.DT603 A-T WC 20-XX cWW cW-W 47 T.DG523 V.DC602 G-C WC 19-XIX cWW cW-W 48 T.DA524 V.DT601 A-T WC 20-XX cWW cW-W **************************************************************************** List of 2 helices Note: a helix is defined by base-stacking interactions, regardless of bp type and backbone connectivity, and may contain more than one stem. helix#number[stems-contained] bps=number-of-base-pairs in the helix bp-type: '|' for a canonical WC/wobble pair, '.' otherwise helix-form: classification of a dinucleotide step comprising the bp above the given designation and the bp that follows it. Types include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices, '.' for an unclassified step, and 'x' for a step without a continuous backbone. -------------------------------------------------------------------- helix#1[1] bps=24 strand-1 5'-TTGTTCTCAGGTACCTCAGCCAGA-3' bp-type |||||||||||||||||||||||| strand-2 3'-AACAAGAGTCCATGGAGTCGGTCT-5' helix-form BB.BB..B.BB.B..B....BBB 1 C.DT501 E.DA624 T-A WC 20-XX cWW cW-W 2 C.DT502 E.DA623 T-A WC 20-XX cWW cW-W 3 C.DG503 E.DC622 G-C WC 19-XIX cWW cW-W 4 C.DT504 E.DA621 T-A WC 20-XX cWW cW-W 5 C.DT505 E.DA620 T-A WC 20-XX cWW cW-W 6 C.DC506 E.DG619 C-G WC 19-XIX cWW cW-W 7 C.DT507 E.DA618 T-A WC 20-XX cWW cW-W 8 C.DC508 E.DG617 C-G WC 19-XIX cWW cW-W 9 C.DA509 E.DT616 A-T WC 20-XX cWW cW-W 10 C.DG510 E.DC615 G-C WC 19-XIX cWW cW-W 11 C.DG511 E.DC614 G-C WC 19-XIX cWW cW-W 12 C.DT512 E.DA613 T-A WC 20-XX cWW cW-W 13 C.DA513 E.DT612 A-T WC 20-XX cWW cW-W 14 C.DC514 E.DG611 C-G WC 19-XIX cWW cW-W 15 C.DC515 E.DG610 C-G WC 19-XIX cWW cW-W 16 C.DT516 E.DA609 T-A WC 20-XX cWW cW-W 17 C.DC517 E.DG608 C-G WC 19-XIX cWW cW-W 18 C.DA518 E.DT607 A-T WC 20-XX cWW cW-W 19 C.DG519 E.DC606 G-C WC 19-XIX cWW cW-W 20 C.DC520 E.DG605 C-G WC 19-XIX cWW cW-W 21 C.DC521 E.DG604 C-G WC 19-XIX cWW cW-W 22 C.DA522 E.DT603 A-T WC 20-XX cWW cW-W 23 C.DG523 E.DC602 G-C WC 19-XIX cWW cW-W 24 C.DA524 E.DT601 A-T WC 20-XX cWW cW-W -------------------------------------------------------------------------- helix#2[1] bps=24 strand-1 5'-TTGTTCTCAGGTACCTCAGCCAGA-3' bp-type |||||||||||||||||||||||| strand-2 3'-AACAAGAGTCCATGGAGTCGGTCT-5' helix-form BBBBB..BBBB.BB.......BB 1 T.DT501 V.DA624 T-A WC 20-XX cWW cW-W 2 T.DT502 V.DA623 T-A WC 20-XX cWW cW-W 3 T.DG503 V.DC622 G-C WC 19-XIX cWW cW-W 4 T.DT504 V.DA621 T-A WC 20-XX cWW cW-W 5 T.DT505 V.DA620 T-A WC 20-XX cWW cW-W 6 T.DC506 V.DG619 C-G WC 19-XIX cWW cW-W 7 T.DT507 V.DA618 T-A WC 20-XX cWW cW-W 8 T.DC508 V.DG617 C-G WC 19-XIX cWW cW-W 9 T.DA509 V.DT616 A-T WC 20-XX cWW cW-W 10 T.DG510 V.DC615 G-C WC 19-XIX cWW cW-W 11 T.DG511 V.DC614 G-C WC 19-XIX cWW cW-W 12 T.DT512 V.DA613 T-A WC 20-XX cWW cW-W 13 T.DA513 V.DT612 A-T WC 20-XX cWW cW-W 14 T.DC514 V.DG611 C-G WC 19-XIX cWW cW-W 15 T.DC515 V.DG610 C-G WC 19-XIX cWW cW-W 16 T.DT516 V.DA609 T-A WC 20-XX cWW cW-W 17 T.DC517 V.DG608 C-G WC 19-XIX cWW cW-W 18 T.DA518 V.DT607 A-T WC 20-XX cWW cW-W 19 T.DG519 V.DC606 G-C WC 19-XIX cWW cW-W 20 T.DC520 V.DG605 C-G WC 19-XIX cWW cW-W 21 T.DC521 V.DG604 C-G WC 19-XIX cWW cW-W 22 T.DA522 V.DT603 A-T WC 20-XX cWW cW-W 23 T.DG523 V.DC602 G-C WC 19-XIX cWW cW-W 24 T.DA524 V.DT601 A-T WC 20-XX cWW cW-W **************************************************************************** List of 2 stems Note: a stem is defined as a helix consisting of only canonical WC/wobble pairs, with a continuous backbone. stem#number[#helix-number containing this stem] Other terms are defined as in the above Helix section. -------------------------------------------------------------------- stem#1[#1] bps=24 strand-1 5'-TTGTTCTCAGGTACCTCAGCCAGA-3' bp-type |||||||||||||||||||||||| strand-2 3'-AACAAGAGTCCATGGAGTCGGTCT-5' helix-form BB.BB..B.BB.B..B....BBB 1 C.DT501 E.DA624 T-A WC 20-XX cWW cW-W 2 C.DT502 E.DA623 T-A WC 20-XX cWW cW-W 3 C.DG503 E.DC622 G-C WC 19-XIX cWW cW-W 4 C.DT504 E.DA621 T-A WC 20-XX cWW cW-W 5 C.DT505 E.DA620 T-A WC 20-XX cWW cW-W 6 C.DC506 E.DG619 C-G WC 19-XIX cWW cW-W 7 C.DT507 E.DA618 T-A WC 20-XX cWW cW-W 8 C.DC508 E.DG617 C-G WC 19-XIX cWW cW-W 9 C.DA509 E.DT616 A-T WC 20-XX cWW cW-W 10 C.DG510 E.DC615 G-C WC 19-XIX cWW cW-W 11 C.DG511 E.DC614 G-C WC 19-XIX cWW cW-W 12 C.DT512 E.DA613 T-A WC 20-XX cWW cW-W 13 C.DA513 E.DT612 A-T WC 20-XX cWW cW-W 14 C.DC514 E.DG611 C-G WC 19-XIX cWW cW-W 15 C.DC515 E.DG610 C-G WC 19-XIX cWW cW-W 16 C.DT516 E.DA609 T-A WC 20-XX cWW cW-W 17 C.DC517 E.DG608 C-G WC 19-XIX cWW cW-W 18 C.DA518 E.DT607 A-T WC 20-XX cWW cW-W 19 C.DG519 E.DC606 G-C WC 19-XIX cWW cW-W 20 C.DC520 E.DG605 C-G WC 19-XIX cWW cW-W 21 C.DC521 E.DG604 C-G WC 19-XIX cWW cW-W 22 C.DA522 E.DT603 A-T WC 20-XX cWW cW-W 23 C.DG523 E.DC602 G-C WC 19-XIX cWW cW-W 24 C.DA524 E.DT601 A-T WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#2[#2] bps=24 strand-1 5'-TTGTTCTCAGGTACCTCAGCCAGA-3' bp-type |||||||||||||||||||||||| strand-2 3'-AACAAGAGTCCATGGAGTCGGTCT-5' helix-form BBBBB..BBBB.BB.......BB 1 T.DT501 V.DA624 T-A WC 20-XX cWW cW-W 2 T.DT502 V.DA623 T-A WC 20-XX cWW cW-W 3 T.DG503 V.DC622 G-C WC 19-XIX cWW cW-W 4 T.DT504 V.DA621 T-A WC 20-XX cWW cW-W 5 T.DT505 V.DA620 T-A WC 20-XX cWW cW-W 6 T.DC506 V.DG619 C-G WC 19-XIX cWW cW-W 7 T.DT507 V.DA618 T-A WC 20-XX cWW cW-W 8 T.DC508 V.DG617 C-G WC 19-XIX cWW cW-W 9 T.DA509 V.DT616 A-T WC 20-XX cWW cW-W 10 T.DG510 V.DC615 G-C WC 19-XIX cWW cW-W 11 T.DG511 V.DC614 G-C WC 19-XIX cWW cW-W 12 T.DT512 V.DA613 T-A WC 20-XX cWW cW-W 13 T.DA513 V.DT612 A-T WC 20-XX cWW cW-W 14 T.DC514 V.DG611 C-G WC 19-XIX cWW cW-W 15 T.DC515 V.DG610 C-G WC 19-XIX cWW cW-W 16 T.DT516 V.DA609 T-A WC 20-XX cWW cW-W 17 T.DC517 V.DG608 C-G WC 19-XIX cWW cW-W 18 T.DA518 V.DT607 A-T WC 20-XX cWW cW-W 19 T.DG519 V.DC606 G-C WC 19-XIX cWW cW-W 20 T.DC520 V.DG605 C-G WC 19-XIX cWW cW-W 21 T.DC521 V.DG604 C-G WC 19-XIX cWW cW-W 22 T.DA522 V.DT603 A-T WC 20-XX cWW cW-W 23 T.DG523 V.DC602 G-C WC 19-XIX cWW cW-W 24 T.DA524 V.DT601 A-T WC 20-XX cWW cW-W **************************************************************************** Secondary structures in dot-bracket notation (dbn) as a whole and per chain >3mxb nts=96 [whole] TTGTTCTCAGGTACCTCAGCCAGA&TCTGGCTGAGGTACCTGAGAACAA&TTGTTCTCAGGTACCTCAGCCAGA&TCTGGCTGAGGTACCTGAGAACAA ((((((((((((((((((((((((&))))))))))))))))))))))))&((((((((((((((((((((((((&)))))))))))))))))))))))) >3mxb-C #1 nts=24 3.25(0.63) [chain] DNA TTGTTCTCAGGTACCTCAGCCAGA (((((((((((((((((((((((( >3mxb-E #2 nts=24 3.26(0.63) [chain] DNA TCTGGCTGAGGTACCTGAGAACAA )))))))))))))))))))))))) >3mxb-T #3 nts=24 3.25(0.60) [chain] DNA TTGTTCTCAGGTACCTCAGCCAGA (((((((((((((((((((((((( >3mxb-V #4 nts=24 3.27(0.66) [chain] DNA TCTGGCTGAGGTACCTGAGAACAA )))))))))))))))))))))))) **************************************************************************** Summary of structural features of 96 nucleotides Note: the first five columns are: (1) serial number, (2) one-letter shorthand name, (3) dbn, (4) id string, (5) rmsd (~zero) of base ring atoms fitted against those in a standard base reference frame. The sixth (last) column contains a comma-separated list of features whose meanings are mostly self-explanatory, except for: turn: angle C1'(i-1)--C1'(i)--C1'(i+1) < 90 degrees break: no backbone linkage between O3'(i-1) and P(i) 1 T ( C.DT501 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end 2 T ( C.DT502 0.008 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 3 G ( C.DG503 0.008 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 4 T ( C.DT504 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 5 T ( C.DT505 0.008 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 6 C ( C.DC506 0.004 anti,BI,canonical,non-pair-contact,helix,stem,phosphate 7 T ( C.DT507 0.007 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 8 C ( C.DC508 0.013 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 9 A ( C.DA509 0.013 anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem 10 G ( C.DG510 0.015 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 11 G ( C.DG511 0.006 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 12 T ( C.DT512 0.007 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 13 A ( C.DA513 0.016 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 14 C ( C.DC514 0.007 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate 15 C ( C.DC515 0.008 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 16 T ( C.DT516 0.012 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 17 C ( C.DC517 0.015 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 18 A ( C.DA518 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 19 G ( C.DG519 0.006 anti,BI,canonical,non-pair-contact,helix,stem,phosphate 20 C ( C.DC520 0.006 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 21 C ( C.DC521 0.005 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 22 A ( C.DA522 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 23 G ( C.DG523 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 24 A ( C.DA524 0.004 anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end 25 T ) E.DT601 0.003 anti,BI,canonical,non-pair-contact,helix-end,stem-end 26 C ) E.DC602 0.004 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate 27 T ) E.DT603 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 28 G ) E.DG604 0.008 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 29 G ) E.DG605 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 30 C ) E.DC606 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 31 T ) E.DT607 0.007 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 32 G ) E.DG608 0.010 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 33 A ) E.DA609 0.007 anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem 34 G ) E.DG610 0.011 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 35 G ) E.DG611 0.007 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 36 T ) E.DT612 0.006 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 37 A ) E.DA613 0.011 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 38 C ) E.DC614 0.008 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate 39 C ) E.DC615 0.008 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 40 T ) E.DT616 0.012 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 41 G ) E.DG617 0.025 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 42 A ) E.DA618 0.008 anti,BI,canonical,non-pair-contact,helix,stem,phosphate 43 G ) E.DG619 0.005 anti,BI,canonical,non-pair-contact,helix,stem,phosphate 44 A ) E.DA620 0.006 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 45 A ) E.DA621 0.009 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 46 C ) E.DC622 0.003 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 47 A ) E.DA623 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 48 A ) E.DA624 0.007 anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end 49 T ( T.DT501 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end 50 T ( T.DT502 0.005 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 51 G ( T.DG503 0.011 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 52 T ( T.DT504 0.008 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate 53 T ( T.DT505 0.011 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 54 C ( T.DC506 0.003 anti,BI,canonical,non-pair-contact,helix,stem,phosphate 55 T ( T.DT507 0.009 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 56 C ( T.DC508 0.014 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 57 A ( T.DA509 0.011 anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem 58 G ( T.DG510 0.015 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 59 G ( T.DG511 0.008 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 60 T ( T.DT512 0.008 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 61 A ( T.DA513 0.011 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 62 C ( T.DC514 0.014 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate 63 C ( T.DC515 0.010 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 64 T ( T.DT516 0.007 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 65 C ( T.DC517 0.019 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 66 A ( T.DA518 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 67 G ( T.DG519 0.009 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 68 C ( T.DC520 0.007 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 69 C ( T.DC521 0.004 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 70 A ( T.DA522 0.008 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 71 G ( T.DG523 0.010 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 72 A ( T.DA524 0.005 anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end 73 T ) V.DT601 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end 74 C ) V.DC602 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 75 T ) V.DT603 0.011 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 76 G ) V.DG604 0.009 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 77 G ) V.DG605 0.006 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 78 C ) V.DC606 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 79 T ) V.DT607 0.004 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 80 G ) V.DG608 0.019 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 81 A ) V.DA609 0.013 anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem 82 G ) V.DG610 0.010 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 83 G ) V.DG611 0.009 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 84 T ) V.DT612 0.007 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 85 A ) V.DA613 0.015 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 86 C ) V.DC614 0.012 anti,~C2'-endo,canonical,non-pair-contact,helix,stem,phosphate 87 C ) V.DC615 0.009 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 88 T ) V.DT616 0.011 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 89 G ) V.DG617 0.022 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 90 A ) V.DA618 0.013 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 91 G ) V.DG619 0.009 anti,BI,canonical,non-pair-contact,helix,stem,phosphate 92 A ) V.DA620 0.010 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 93 A ) V.DA621 0.008 anti,~C2'-endo,canonical,non-pair-contact,helix,stem 94 C ) V.DC622 0.007 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 95 A ) V.DA623 0.006 anti,~C2'-endo,BI,canonical,non-pair-contact,helix,stem 96 A ) V.DA624 0.006 anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end **************************************************************************** List of 7 additional files 1 dssr-pairs.pdb -- an ensemble of base pairs 2 dssr-stems.pdb -- an ensemble of stems 3 dssr-helices.pdb -- an ensemble of helices (coaxial stacking) 4 dssr-2ndstrs.bpseq -- secondary structure in bpseq format 5 dssr-2ndstrs.ct -- secondary structure in connectivity table format 6 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation 7 dssr-torsions.txt -- backbone torsion angles and suite names