**************************************************************************** Note: By default, each nucleotide is identified by chainId.name#. So a common case would be B.A1689, meaning adenosine #1689 on chain B. One-letter base names for modified nucleotides are put in lower case (e.g., 'c' for 5MC). For further information about the output notation, please refer to the DSSR User Manual. Questions and suggestions are *always* welcome on the 3DNA Forum. Command: x3dna-dssr -i=3j7y.pdb -o=3j7y.out File name: 3j7y.pdb no. of DNA/RNA chains: 2 [A=1473,B=57] no. of nucleotides: 1530 no. of atoms: 94121 no. of waters: 0 no. of metals: 69 [Mg=66,Zn=3] **************************************************************************** List of 671 base pairs nt1 nt2 bp name Saenger LW DSSR 1 A.G1671 A.C1817 G-C WC 19-XIX cWW cW-W 2 A.C1672 A.G1816 C-G WC 19-XIX cWW cW-W 3 A.U1673 A.A1815 U-A -- -- cWH cW-M 4 A.C1678 A.G1797 C-G WC 19-XIX cWW cW-W 5 A.U1679 A.A1773 U-A rHoogsteen 24-XXIV tWH tW-M 6 A.A1680 A.A1772 A-A ~Sheared -- tHS tM-m 7 A.A1680 A.A1775 A+A -- 01-I tWW tW+W 8 A.G1681 A.C1771 G-C WC 19-XIX cWW cW-W 9 A.G1681 A.G1776 G+G -- 04-IV tSS tm+m 10 A.C1682 A.G1770 C-G WC 19-XIX cWW cW-W 11 A.C1683 A.G1768 C-G WC 19-XIX cWW cW-W 12 A.C1684 A.G1767 C-G WC 19-XIX cWW cW-W 13 A.C1698 A.A1702 C-A -- -- cSS cm-m 14 A.A1718 A.C1911 A-C -- -- cWS cW-m 15 A.A1718 A.G2008 A+G -- -- tW. tW+. 16 A.G1719 A.G2009 G+G -- 04-IV tSS tm+m 17 A.C1720 A.U2010 C-U -- -- tSH tm-M 18 A.C1721 A.U1730 C-U -- 18-XVIII cWW cW-W 19 A.A1722 A.U1729 A-U WC 20-XX cWW cW-W 20 A.A1723 A.G1750 A-G -- -- cSW cm-W 21 A.A1724 A.G2040 A+G -- 10-X tWS tW+m 22 A.C1726 A.G1748 C-G WC 19-XIX cWW cW-W 23 A.U1728 A.G1750 U+G rWobble 27-XXVII tWW tW+W 24 A.U1729 A.A1751 U+A -- -- tSW tm+W 25 A.A1737 A.G1760 A-G Sheared 11-XI tHS tM-m 26 A.U1738 A.U1759 U-U -- 16-XVI cWW cW-W 27 A.U1738 A.G1888 U+G -- -- t.W t.+W 28 A.A1739 A.U1758 A-U WC 20-XX cWW cW-W 29 A.A1740 A.A1757 A-A ~Sheared -- tSH tm-M 30 A.A1741 A.A1756 A+A -- 02-II tHH tM+M 31 A.G1742 A.U1743 G+U Platform -- cSH cm+M 32 A.U1743 A.A1755 U-A rHoogsteen 24-XXIV tWH tW-M 33 A.A1744 A.G1754 A-G Sheared 11-XI tHS tM-m 34 A.U1745 A.A1753 U-A WC 20-XX cWW cW-W 35 A.A1746 A.U1752 A-U WC 20-XX cWW cW-W 36 A.G1747 A.A1751 G-A Sheared 11-XI tSH tm-M 37 A.C1769 A.G2289 C+G -- -- tWS tW+m 38 A.U1778 A.A1781 U+A -- -- tSW tm+W 39 A.A1781 A.A1795 A+A -- 02-II tHH tM+M 40 A.G1782 A.U1783 G+U Platform -- cSH cm+M 41 A.U1783 A.A1794 U-A rHoogsteen 24-XXIV tWH tW-M 42 A.A1784 A.G1793 A-G Sheared 11-XI tHS tM-m 43 A.C1785 A.G1792 C-G WC 19-XIX cWW cW-W 44 A.C1786 A.G1791 C-G WC 19-XIX cWW cW-W 45 A.G1787 A.A1790 G-A Sheared 11-XI tSH tm-M 46 A.A1789 A.C1915 A-C -- -- cSS cm-m 47 A.A1790 A.C2005 A+C -- -- tWS tW+m 48 A.U1799 A.A1803 U-A rHoogsteen 24-XXIV tWH tW-M 49 A.G1800 A.A1805 G-A Sheared 11-XI tSH tm-M 50 A.A1803 A.U1807 A-U WC 20-XX cWW cW-W 51 A.A1815 A.G2304 A+G Linker -- tSS tm+m 52 A.A1825 A.A2704 A+A -- -- cHW cM+W 53 A.A1825 A.U2705 A+U Hoogsteen 23-XXIII cHW cM+W 54 A.G1826 A.A2704 G-A Imino 08-VIII cWW cW-W 55 A.C1827 A.G2681 C-G WC 19-XIX cWW cW-W 56 A.A1828 A.C2683 A+C -- -- cHS cM+m 57 A.A1829 A.U1841 A-U WC 20-XX cWW cW-W 58 A.G1830 A.C1840 G-C WC 19-XIX cWW cW-W 59 A.G1831 A.C1839 G-C WC 19-XIX cWW cW-W 60 A.C1833 A.A1835 C+A -- -- tWS tW+m 61 A.U1843 A.A2696 U-A WC 20-XX cWW cW-W 62 A.A1844 A.A1859 A-A -- -- cWW cW-W 63 A.C1845 A.G1858 C-G WC 19-XIX cWW cW-W 64 A.C1845 A.A2297 C+A -- -- tSW tm+W 65 A.C1846 A.U1857 C-U -- 18-XVIII cWW cW-W 66 A.U1847 A.A1856 U-A WC 20-XX cWW cW-W 67 A.C1849 A.A2693 C-A -- -- t.H t.-M 68 A.U1850 A.A2134 U-A -- -- cSW cm-W 69 A.A1853 A.G2692 A+G -- 10-X tWS tW+m 70 A.G1858 A.A2297 G-A -- -- cSS cm-m 71 A.A1860 A.U2305 A-U WC 20-XX cWW cW-W 72 A.U1861 A.G2304 U-G Wobble 28-XXVIII cWW cW-W 73 A.U1862 A.A2303 U-A WC 20-XX cWW cW-W 74 A.A1863 A.U2301 A-U WC 20-XX cWW cW-W 75 A.A1863 A.U2302 A-U -- -- cWW cW-W 76 A.A1864 A.G2300 A-G -- -- cWW cW-W 77 A.A1864 A.U2301 A-U -- -- cWW cW-W 78 A.C1865 A.G2300 C-G WC 19-XIX cWW cW-W 79 A.U1866 A.A2298 U-A -- -- t.H t.-M 80 A.A1867 A.G2019 A+G Linker -- tSS tm+m 81 A.A1867 A.C2295 A+C -- -- tHH tM+M 82 A.G1868 A.U2020 G-U -- -- cWW cW-W 83 A.A1871 A.C1901 A-C ~Wobble -- cWW cW-W 84 A.U1872 A.C1901 U+C -- -- cH. cM+. 85 A.A1873 A.A1900 A-A -- -- c.W c.-W 86 A.A1874 A.G1899 A-G -- -- cWW cW-W 87 A.C1875 A.G1899 C-G WC 19-XIX cWW cW-W 88 A.U1876 A.A1897 U-A WC 20-XX cWW cW-W 89 A.U1876 A.A1898 U-A -- -- cWW cW-W 90 A.U1877 A.A1897 U-A -- -- cWW cW-W 91 A.U1878 A.U1896 U-U -- -- cWW cW-W 92 A.G1879 A.C1895 G-C WC 19-XIX cWW cW-W 93 A.C1880 A.G1894 C-G WC 19-XIX cWW cW-W 94 A.A1882 A.A1891 A+A -- -- tWS tW+m 95 A.G1883 A.C1890 G-C WC 19-XIX cWW cW-W 96 A.G1884 A.C1889 G-C WC 19-XIX cWW cW-W 97 A.C1903 A.G2019 C-G WC 19-XIX cWW cW-W 98 A.C1904 A.G2018 C-G WC 19-XIX cWW cW-W 99 A.C1905 A.U2017 C-U -- -- cWW cW-W 100 A.G1906 A.C2016 G-C WC 19-XIX cWW cW-W 101 A.A1907 A.U2013 A-U rHoogsteen 24-XXIV tHW tM-W 102 A.A1907 A.U2930 A-U -- -- cSS cm-m 103 A.A1908 A.A2012 A-A -- 05-V tHW tM-W 104 A.A1908 A.G2732 A+G Linker -- tSS tm+m 105 A.A1909 A.U2010 A+U -- -- tWW tW+W 106 A.C1910 A.G2009 C-G WC 19-XIX cWW cW-W 107 A.C1911 A.G2008 C-G WC 19-XIX cWW cW-W 108 A.A1912 A.U2007 A-U WC 20-XX cWW cW-W 109 A.G1913 A.C2006 G-C WC 19-XIX cWW cW-W 110 A.A1914 A.C2005 A-C ~Wobble -- cWW cW-W 111 A.C1915 A.G2004 C-G WC 19-XIX cWW cW-W 112 A.G1916 A.G1985 G-G -- 07-VII tWH tW-M 113 A.A1917 A.U1920 A+U -- -- tSW tm+W 114 A.A1917 A.G1988 A+G -- 10-X tWS tW+m 115 A.G1918 A.U1998 G-U -- -- cSW cm-W 116 A.C1919 A.A2500 C-A -- -- cSW cm-W 117 A.A1921 A.U1983 A-U WC 20-XX cWW cW-W 118 A.C1922 A.G1982 C-G WC 19-XIX cWW cW-W 119 A.C1923 A.G1981 C-G WC 19-XIX cWW cW-W 120 A.U1924 A.A1980 U-A WC 20-XX cWW cW-W 121 A.A1925 A.U1979 A-U WC 20-XX cWW cW-W 122 A.A1926 A.A1978 A-A -- -- cWW cW-W 123 A.G1927 A.U1977 G-U Wobble 28-XXVIII cWW cW-W 124 A.A1928 A.U1976 A-U WC 20-XX cWW cW-W 125 A.A1929 A.U1975 A-U WC 20-XX cWW cW-W 126 A.C1930 A.G1973 C-G WC 19-XIX cWW cW-W 127 A.A1931 A.A1943 A-A ~Sheared -- tHS tM-m 128 A.G1932 A.C1942 G-C WC 19-XIX cWW cW-W 129 A.C1933 A.G1941 C-G WC 19-XIX cWW cW-W 130 A.U1934 A.A1940 U-A WC 20-XX cWW cW-W 131 A.A1935 A.A1938 A+A -- -- tSW tm+W 132 A.G1939 A.C2494 G-C WC 19-XIX cWW cW-W 133 A.A1945 A.A1971 A-A ~Sheared -- tHS tM-m 134 A.C1946 A.G1970 C-G WC 19-XIX cWW cW-W 135 A.C1947 A.G1969 C-G WC 19-XIX cWW cW-W 136 A.C1948 A.G1968 C-G WC 19-XIX cWW cW-W 137 A.G1949 A.U1950 G+U Platform -- cSH cm+M 138 A.G1949 A.U1967 G-U -- -- cWW cW-W 139 A.U1950 A.U1967 U-U -- 16-XVI cWW cW-W 140 A.C1951 A.G1966 C-G WC 19-XIX cWW cW-W 141 A.U1952 A.A1965 U-A WC 20-XX cWW cW-W 142 A.A1953 A.U1964 A-U WC 20-XX cWW cW-W 143 A.U1954 A.A1963 U-A WC 20-XX cWW cW-W 144 A.G1955 A.A1960 G+A -- 10-X tSW tm+W 145 A.C1959 A.A1963 C-A -- -- cWS cW-m 146 A.A1962 A.U3096 A-U WC 20-XX cWW cW-W 147 A.G1968 A.A2644 G-A -- -- cSW cm-W 148 A.A1974 A.U2495 A+U Hoogsteen 23-XXIII cHW cM+W 149 A.A1974 A.A2509 A-A -- -- cWS cW-m 150 A.A1984 A.G1987 A+G -- -- cSS cm+m 151 A.G1985 A.C2001 G-C WC 19-XIX cWW cW-W 152 A.G1987 A.C1997 G-C WC 19-XIX cWW cW-W 153 A.G1988 A.C1996 G-C WC 19-XIX cWW cW-W 154 A.C1989 A.A1995 C-A -- -- cWW cW-W 155 A.G1990 A.A1993 G+A -- 10-X tSW tm+W 156 A.A1991 A.G2496 A+G Linker -- tSS tm+m 157 A.A1994 A.A2003 A-A -- -- tSW tm-W 158 A.G2002 A.G2735 G-G -- -- cSS cm-m 159 A.U2017 A.A2723 U-A -- -- cSW cm-W 160 A.G2018 A.A2298 G-A -- -- cSS cm-m 161 A.G2022 A.C2271 G-C WC 19-XIX cWW cW-W 162 A.U2023 A.A2270 U-A WC 20-XX cWW cW-W 163 A.C2024 A.G2269 C-G WC 19-XIX cWW cW-W 164 A.C2025 A.G2268 C-G WC 19-XIX cWW cW-W 165 A.A2026 A.U2267 A-U WC 20-XX cWW cW-W 166 A.A2027 A.U2266 A-U WC 20-XX cWW cW-W 167 A.G2028 A.A2265 G-A Sheared 11-XI tSH tm-M 168 A.U2030 A.C2123 U-C -- -- t.W t.-W 169 A.A2031 A.A2044 A-A ~Sheared -- tHS tM-m 170 A.G2032 A.C2043 G-C WC 19-XIX cWW cW-W 171 A.A2033 A.U2041 A-U WC 20-XX cWW cW-W 172 A.A2033 A.U2042 A-U -- -- cWW cW-W 173 A.A2034 A.G2040 A-G -- -- cWW cW-W 174 A.A2034 A.U2041 A-U -- -- cWW cW-W 175 A.U2035 A.G2040 U-G Wobble 28-XXVIII cWW cW-W 176 A.A2039 A.A2097 A-A -- -- tSW tm-W 177 A.A2039 A.G2932 A-G -- -- cWS cW-m 178 A.U2042 A.U2096 U+U -- -- tHH tM+M 179 A.A2045 A.U2095 A-U WC 20-XX cWW cW-W 180 A.C2046 A.U2093 C-U -- -- cWW cW-W 181 A.C2046 A.G2094 C-G WC 19-XIX cWW cW-W 182 A.U2047 A.C2092 U-C -- -- cWW cW-W 183 A.U2048 A.A2091 U-A WC 20-XX cWW cW-W 184 A.U2049 A.A2090 U-A WC 20-XX cWW cW-W 185 A.A2050 A.U2089 A-U WC 20-XX cWW cW-W 186 A.A2051 A.U2088 A-U WC 20-XX cWW cW-W 187 A.A2052 A.U2087 A-U WC 20-XX cWW cW-W 188 A.U2053 A.A2085 U-A -- -- cWW cW-W 189 A.U2053 A.A2086 U-A WC 20-XX cWW cW-W 190 A.U2054 A.A2085 U-A WC 20-XX cWW cW-W 191 A.U2055 A.A2084 U-A WC 20-XX cWW cW-W 192 A.G2056 A.U2083 G-U Wobble 28-XXVIII cWW cW-W 193 A.C2057 A.U2081 C-U -- -- cWW cW-W 194 A.C2057 A.G2082 C-G WC 19-XIX cWW cW-W 195 A.C2058 A.U2080 C+U -- -- tWW tW+W 196 A.C2058 A.U2081 C-U -- 18-XVIII cWW cW-W 197 A.C2059 A.C2079 C+C -- -- tSW tm+W 198 A.A2060 A.C2078 A-C -- -- tHS tM-m 199 A.A2062 A.C2077 A-C -- -- cWW cW-W 200 A.G2063 A.C2076 G-C WC 19-XIX cWW cW-W 201 A.A2064 A.U2075 A-U WC 20-XX cWW cW-W 202 A.A2073 A.A2832 A-A -- -- tHW tM-W 203 A.U2075 A.A2833 U-A -- -- tSH tm-M 204 A.G2098 A.A2122 G-A Imino 08-VIII cWW cW-W 205 A.G2098 A.C2123 G-C WC 19-XIX cWW cW-W 206 A.U2099 A.A2122 U-A WC 20-XX cWW cW-W 207 A.U2099 A.A2135 U-A -- -- tSH tm-M 208 A.C2100 A.G2121 C-G WC 19-XIX cWW cW-W 209 A.C2101 A.G2120 C-G WC 19-XIX cWW cW-W 210 A.A2102 A.U2119 A-U WC 20-XX cWW cW-W 211 A.A2103 A.U2118 A-U WC 20-XX cWW cW-W 212 A.A2104 A.U2117 A-U WC 20-XX cWW cW-W 213 A.G2105 A.C2116 G-C WC 19-XIX cWW cW-W 214 A.G2105 A.A2837 G+A -- -- t.W t.+W 215 A.A2106 A.U2115 A-U WC 20-XX cWW cW-W 216 A.G2107 A.C2114 G-C WC 19-XIX cWW cW-W 217 A.G2107 A.G2814 G-G -- -- cSW cm-W 218 A.G2108 A.A2112 G-A Sheared 11-XI tSH tm-M 219 A.A2112 A.G2943 A-G -- -- cSS cm-m 220 A.C2123 A.A2134 C-A -- -- cSS cm-m 221 A.C2125 A.G2140 C-G WC 19-XIX cWW cW-W 222 A.A2127 A.U2138 A-U WC 20-XX cWW cW-W 223 A.G2128 A.C2137 G-C WC 19-XIX cWW cW-W 224 A.G2128 A.A2152 G+A Linker -- tSS tm+m 225 A.G2129 A.C2136 G-C WC 19-XIX cWW cW-W 226 A.A2131 A.G2700 A-G -- -- cWS cW-m 227 A.A2132 A.G2690 A+G Linker -- tSS tm+m 228 A.U2138 A.A2151 U-A -- -- cSS cm-m 229 A.G2143 A.C2257 G-C WC 19-XIX cWW cW-W 230 A.A2144 A.U2256 A-U WC 20-XX cWW cW-W 231 A.G2145 A.C2255 G-C WC 19-XIX cWW cW-W 232 A.G2147 A.C2254 G-C WC 19-XIX cWW cW-W 233 A.A2148 A.U2253 A-U WC 20-XX cWW cW-W 234 A.G2149 A.C2252 G-C WC 19-XIX cWW cW-W 235 A.U2150 A.A2250 U-A rHoogsteen 24-XXIV tWH tW-M 236 A.A2152 A.G2249 A-G Sheared 11-XI tHS tM-m 237 A.A2153 A.U2248 A-U WC 20-XX cWW cW-W 238 A.C2165 A.C2215 C-C -- -- tW. tW-. 239 A.C2166 A.A2214 C-A -- -- t.H t.-M 240 A.A2167 A.A2213 A-A -- -- tWH tW-M 241 A.U2168 A.A2192 U-A WC 20-XX cWW cW-W 242 A.G2170 A.C2190 G-C WC 19-XIX cWW cW-W 243 A.G2173 A.C2187 G-C WC 19-XIX cWW cW-W 244 A.G2174 A.C2186 G-C WC 19-XIX cWW cW-W 245 A.G2174 A.C2187 G-C -- -- cWW cW-W 246 A.C2175 A.G2185 C-G WC 19-XIX cWW cW-W 247 A.C2176 A.A2184 C-A -- -- cWW cW-W 248 A.U2177 A.A2180 U-A -- -- tSH tm-M 249 A.G2182 A.G2201 G+G -- 06-VI cWH cW+M 250 A.G2182 A.C2210 G-C -- -- tW. tW-. 251 A.C2183 A.C2202 C+C -- -- cWH cW+M 252 A.C2183 A.G2209 C-G -- -- -- -- 253 A.G2197 A.C2212 G-C WC 19-XIX cWW cW-W 254 A.A2199 A.A2200 A+A Platform -- cSH cm+M 255 A.A2200 A.U2211 A-U WC 20-XX cWW cW-W 256 A.G2201 A.C2210 G-C WC 19-XIX cWW cW-W 257 A.C2202 A.G2209 C-G WC 19-XIX cWW cW-W 258 A.G2203 A.A2208 G-A Sheared 11-XI tSH tm-M 259 A.U2204 A.A2207 U-A -- -- tSH tm-M 260 A.A2229 A.A2951 A-A -- -- cWS cW-m 261 A.A2229 A.A2974 A+A -- -- cHS cM+m 262 A.A2230 A.U2950 A-U -- -- cWS cW-m 263 A.A2231 A.A3003 A-A -- -- cSS cm-m 264 A.A2232 A.G3002 A-G -- -- cSS cm-m 265 A.A2232 A.C3056 A+C -- -- tWS tW+m 266 A.C2263 A.A2264 C+A Platform -- cWH cW+M 267 A.C2272 A.A2294 C-A -- -- cWW cW-W 268 A.A2273 A.A2293 A-A -- -- cWS cW-m 269 A.A2274 A.A2291 A+A -- -- cHW cM+W 270 A.U2275 A.A2290 U-A WC 20-XX cWW cW-W 271 A.C2276 A.G2289 C-G WC 19-XIX cWW cW-W 272 A.U2277 A.A2288 U-A WC 20-XX cWW cW-W 273 A.A2278 A.U2287 A-U WC 20-XX cWW cW-W 274 A.U2279 A.A2286 U-A WC 20-XX cWW cW-W 275 A.C2280 A.U2285 C-U -- 18-XVIII cWW cW-W 276 A.A2306 A.U2680 A-U WC 20-XX cWW cW-W 277 A.U2307 A.U2679 U-U -- 16-XVI cWW cW-W 278 A.A2308 A.A2678 A-A ~Sheared -- tSH tm-M 279 A.A2309 A.A2677 A+A -- 02-II tHH tM+M 280 A.G2310 A.U2311 G+U Platform -- cSH cm+M 281 A.U2311 A.A2676 U-A rHoogsteen 24-XXIV tWH tW-M 282 A.A2312 A.G2675 A-G Sheared 11-XI tHS tM-m 283 A.A2313 A.U2674 A-U WC 20-XX cWW cW-W 284 A.C2314 A.G2673 C-G WC 19-XIX cWW cW-W 285 A.A2315 A.G2453 A-G -- -- cHH cM-M 286 A.A2315 A.A2672 A+A -- -- cHW cM+W 287 A.G2317 A.C2326 G-C WC 19-XIX cWW cW-W 288 A.A2318 A.U2325 A-U WC 20-XX cWW cW-W 289 A.A2319 A.U2324 A-U WC 20-XX cWW cW-W 290 A.U2327 A.A2450 U-A WC 20-XX cWW cW-W 291 A.C2328 A.G2449 C-G WC 19-XIX cWW cW-W 292 A.C2328 A.A2451 C-A -- -- cSW cm-W 293 A.C2329 A.G2448 C-G WC 19-XIX cWW cW-W 294 A.U2330 A.A2447 U+A -- -- cWH cW+M 295 A.G2333 A.C2441 G-C WC 19-XIX cWW cW-W 296 A.C2334 A.G2440 C-G WC 19-XIX cWW cW-W 297 A.A2335 A.U2439 A-U WC 20-XX cWW cW-W 298 A.U2336 A.A2438 U-A WC 20-XX cWW cW-W 299 A.C2340 A.A2424 C-A -- -- cWW cW-W 300 A.U2342 A.U2371 U+U -- -- tWW tW+W 301 A.G2343 A.C2423 G-C WC 19-XIX cWW cW-W 302 A.G2345 A.C2368 G-C WC 19-XIX cWW cW-W 303 A.U2346 A.A2367 U-A WC 20-XX cWW cW-W 304 A.C2347 A.G2366 C-G WC 19-XIX cWW cW-W 305 A.A2348 A.U2365 A-U WC 20-XX cWW cW-W 306 A.G2349 A.C2364 G-C WC 19-XIX cWW cW-W 307 A.A2373 A.U2422 A-U rHoogsteen 24-XXIV tHW tM-W 308 A.C2375 A.G2421 C-G WC 19-XIX cWW cW-W 309 A.A2376 A.U2420 A-U WC 20-XX cWW cW-W 310 A.G2377 A.C2419 G-C WC 19-XIX cWW cW-W 311 A.C2378 A.A2418 C-A -- -- cWW cW-W 312 A.A2381 A.U2411 A-U WC 20-XX cWW cW-W 313 A.A2382 A.U2410 A-U WC 20-XX cWW cW-W 314 A.U2383 A.A2409 U-A WC 20-XX cWW cW-W 315 A.A2384 A.U2408 A-U WC 20-XX cWW cW-W 316 A.U2385 A.U2407 U-U -- 16-XVI cWW cW-W 317 A.A2390 A.A2399 A-A -- 05-V tHW tM-W 318 A.U2392 A.C2397 U-C -- -- cW. cW-. 319 A.C2400 A.G2403 C-G WC 19-XIX cWW cW-W 320 A.C2427 A.G2436 C-G WC 19-XIX cWW cW-W 321 A.C2428 A.G2435 C-G WC 19-XIX cWW cW-W 322 A.G2449 A.A2451 G+A -- -- c.H c.+M 323 A.G2453 A.C2671 G-C WC 19-XIX cWW cW-W 324 A.G2454 A.C2670 G-C WC 19-XIX cWW cW-W 325 A.U2455 A.A2669 U-A WC 20-XX cWW cW-W 326 A.U2456 A.A2668 U-A WC 20-XX cWW cW-W 327 A.A2460 A.U2667 A-U -- -- cWW cW-W 328 A.A2461 A.U2666 A-U WC 20-XX cWW cW-W 329 A.A2462 A.U2665 A-U WC 20-XX cWW cW-W 330 A.A2463 A.U2664 A-U WC 20-XX cWW cW-W 331 A.G2464 A.A2662 G-A Imino 08-VIII cWW cW-W 332 A.G2464 A.C2663 G-C WC 19-XIX cWW cW-W 333 A.U2465 A.A2662 U-A WC 20-XX cWW cW-W 334 A.A2466 A.U2660 A-U WC 20-XX cWW cW-W 335 A.A2466 A.U2661 A-U -- -- cWW cW-W 336 A.A2468 A.G2655 A-G -- -- tHH tM-M 337 A.A2468 A.C2659 A+C ~rWobble 26-XXVI tWW tW+W 338 A.A2469 A.U2658 A-U WC 20-XX cWW cW-W 339 A.G2470 A.C2657 G-C WC 19-XIX cWW cW-W 340 A.G2471 A.U2656 G-U -- -- tS. tm-. 341 A.A2472 A.A2480 A+A -- -- cWW cW+W 342 A.A2472 A.U2654 A-U rHoogsteen 24-XXIV tHW tM-W 343 A.A2473 A.U2656 A-U WC 20-XX cWW cW-W 344 A.G2478 A.A2481 G+A -- -- tSW tm+W 345 A.G2478 A.A2482 G+A -- -- t.W t.+W 346 A.G2478 A.C2653 G-C WC 19-XIX cWW cW-W 347 A.U2483 A.G2652 U-G -- -- cWS cW-m 348 A.U2486 A.U2649 U-U -- 16-XVI cWW cW-W 349 A.A2487 A.U2648 A-U WC 20-XX cWW cW-W 350 A.C2488 A.G2647 C-G WC 19-XIX cWW cW-W 351 A.C2489 A.G2646 C-G WC 19-XIX cWW cW-W 352 A.C2490 A.G2645 C-G WC 19-XIX cWW cW-W 353 A.C2491 A.G2643 C-G WC 19-XIX cWW cW-W 354 A.G2492 A.C2642 G-C WC 19-XIX cWW cW-W 355 A.C2494 A.U2510 C-U ~Sheared -- tHS tM-m 356 A.U2495 A.A2509 U-A -- -- tHW tM-W 357 A.G2496 A.C2508 G-C WC 19-XIX cWW cW-W 358 A.U2497 A.A2507 U-A WC 20-XX cWW cW-W 359 A.U2498 A.A2505 U-A rHoogsteen 24-XXIV tWH tW-M 360 A.U2499 A.A2504 U-A rHoogsteen 24-XXIV tWH tW-M 361 A.C2502 A.C3073 C+C -- 14-XIV tWW tW+W 362 A.A2503 A.G3094 A-G -- -- cSS cm-m 363 A.C2511 A.A2539 C+A -- -- tWS tW+m 364 A.A2512 A.C2538 A-C ~Wobble -- cWW cW-W 365 A.C2513 A.G2537 C-G WC 19-XIX cWW cW-W 366 A.C2514 A.G2536 C-G WC 19-XIX cWW cW-W 367 A.U2515 A.A2535 U-A WC 20-XX cWW cW-W 368 A.C2516 A.G2534 C-G WC 19-XIX cWW cW-W 369 A.U2517 A.A2533 U-A WC 20-XX cWW cW-W 370 A.A2518 A.U2532 A-U WC 20-XX cWW cW-W 371 A.C2520 A.G2528 C+G rWC 22-XXII tWW tW+W 372 A.C2520 A.U2529 C+U -- -- tWW tW+W 373 A.C2520 A.A2530 C+A -- -- tHH tM+M 374 A.G2537 A.A2633 G-A -- -- cSS cm-m 375 A.C2541 A.U2638 C-U -- -- cWW cW-W 376 A.G2542 A.C2637 G-C WC 19-XIX cWW cW-W 377 A.C2543 A.G2636 C-G WC 19-XIX cWW cW-W 378 A.C2544 A.A2632 C+A -- -- tSW tm+W 379 A.C2544 A.G2635 C-G WC 19-XIX cWW cW-W 380 A.U2545 A.A2633 U+A Hoogsteen 23-XXIII cWH cW+M 381 A.G2546 A.C2569 G-C WC 19-XIX cWW cW-W 382 A.C2547 A.G2568 C-G WC 19-XIX cWW cW-W 383 A.C2548 A.G2567 C-G WC 19-XIX cWW cW-W 384 A.C2548 A.A2590 C-A -- -- cSS cm-m 385 A.C2549 A.A2565 C-A ~rHoogsteen 25-XXV tWH tW-M 386 A.G2551 A.C2566 G-C WC 19-XIX cWW cW-W 387 A.U2552 A.A2565 U-A WC 20-XX cWW cW-W 388 A.G2553 A.U2562 G-U Wobble 28-XXVIII cWW cW-W 389 A.A2554 A.U2561 A-U WC 20-XX cWW cW-W 390 A.C2555 A.G2560 C-G WC 19-XIX cWW cW-W 391 A.A2556 A.U2559 A-U WC 20-XX cWW cW-W 392 A.U2563 A.C2566 U+C -- -- cWH cW+M 393 A.G2567 A.A2590 G+A Linker -- t.W t.+W 394 A.G2568 A.A2591 G+A Linker -- tSS tm+m 395 A.C2570 A.G2587 C-G WC 19-XIX cWW cW-W 396 A.G2571 A.U2586 G-U Wobble 28-XXVIII cWW cW-W 397 A.C2572 A.G2585 C-G WC 19-XIX cWW cW-W 398 A.G2573 A.C2584 G-C WC 19-XIX cWW cW-W 399 A.G2574 A.C2583 G-C WC 19-XIX cWW cW-W 400 A.U2575 A.A2582 U-A -- -- tWH tW-M 401 A.C2588 A.G2592 C+G rWC 22-XXII tWW tW+W 402 A.A2589 A.A2591 A-A -- -- tSH tm-M 403 A.G2593 A.U2594 G+U Platform -- cSH cm+M 404 A.U2594 A.A2632 U-A rHoogsteen 24-XXIV tWH tW-M 405 A.A2595 A.G2631 A-G Sheared 11-XI tHS tM-m 406 A.G2596 A.U2630 G-U Wobble 28-XXVIII cWW cW-W 407 A.C2597 A.G2627 C-G WC 19-XIX cWW cW-W 408 A.U2599 A.C2625 U+C -- -- tWW tW+W 409 A.A2600 A.G2627 A+G -- -- tWS tW+m 410 A.G2608 A.C2624 G-C WC 19-XIX cWW cW-W 411 A.U2609 A.A2623 U-A WC 20-XX cWW cW-W 412 A.U2610 A.G2622 U-G Wobble 28-XXVIII cWW cW-W 413 A.C2611 A.G2621 C-G WC 19-XIX cWW cW-W 414 A.C2612 A.G2620 C-G WC 19-XIX cWW cW-W 415 A.U2613 A.A2619 U-A -- -- cWW cW-W 416 A.A2615 A.G3047 A-G -- -- cWS cW-m 417 A.A2616 A.G3036 A+G Linker -- tSS tm+m 418 A.U2618 A.C3043 U-C ~rHoogsteen -- tHW tM-W 419 A.A2632 A.G2635 A-G -- -- cSS cm-m 420 A.G2655 A.C2659 G-C -- -- cWW cW-W 421 A.A2676 A.U3100 A+U rWC 21-XXI tWW tW+W 422 A.A2682 A.G2698 A-G Imino 08-VIII cWW cW-W 423 A.C2683 A.G2697 C-G WC 19-XIX cWW cW-W 424 A.G2686 A.C2703 G-C WC 19-XIX cWW cW-W 425 A.C2687 A.G2702 C-G WC 19-XIX cWW cW-W 426 A.C2688 A.G2701 C-G WC 19-XIX cWW cW-W 427 A.C2689 A.G2700 C-G WC 19-XIX cWW cW-W 428 A.G2690 A.C2699 G-C WC 19-XIX cWW cW-W 429 A.U2691 A.A2696 U-A rHoogsteen 24-XXIV tWH tW-M 430 A.A2694 A.C2942 A-C -- -- cSS cm-m 431 A.C2710 A.A3220 C-A -- -- cSW cm-W 432 A.A2711 A.U3107 A-U WC 20-XX cWW cW-W 433 A.G2712 A.C3106 G-C WC 19-XIX cWW cW-W 434 A.C2713 A.A3105 C-A ~Wobble -- cWW cW-W 435 A.A2714 A.A2715 A+A Platform -- cSH cm+M 436 A.A2715 A.U3104 A-U WC 20-XX cWW cW-W 437 A.G2716 A.C3103 G-C WC 19-XIX cWW cW-W 438 A.A2717 A.A3064 A-A -- 05-V tHW tM-W 439 A.A2717 A.U3102 A-U WC 20-XX cWW cW-W 440 A.C2718 A.C2986 C+C -- -- tW. tW+. 441 A.G2719 A.C3099 G-C WC 19-XIX cWW cW-W 442 A.A2720 A.U3098 A-U WC 20-XX cWW cW-W 443 A.G2724 A.A2938 G-A -- -- cWW cW-W 444 A.G2724 A.C2988 G+C -- -- cHS cM+m 445 A.C2726 A.A2937 C-A ~Wobble -- cWW cW-W 446 A.C2727 A.G2933 C-G WC 19-XIX cWW cW-W 447 A.C2728 A.G2932 C-G WC 19-XIX cWW cW-W 448 A.U2729 A.A2931 U-A WC 20-XX cWW cW-W 449 A.A2730 A.U2930 A-U WC 20-XX cWW cW-W 450 A.U2731 A.A2918 U+A -- -- tWW tW+W 451 A.G2732 A.C2929 G-C WC 19-XIX cWW cW-W 452 A.G2733 A.C2928 G-C WC 19-XIX cWW cW-W 453 A.A2734 A.U2925 A-U WC 20-XX cWW cW-W 454 A.G2735 A.U2924 G-U Wobble 28-XXVIII cWW cW-W 455 A.C2736 A.G2923 C-G WC 19-XIX cWW cW-W 456 A.U2737 A.A2922 U-A WC 20-XX cWW cW-W 457 A.U2738 A.A2740 U+A -- -- cWH cW+M 458 A.A2740 A.U2807 A-U WC 20-XX cWW cW-W 459 A.A2741 A.U2806 A-U WC 20-XX cWW cW-W 460 A.U2742 A.A2805 U-A WC 20-XX cWW cW-W 461 A.U2743 A.A2804 U-A WC 20-XX cWW cW-W 462 A.U2744 A.A2803 U-A WC 20-XX cWW cW-W 463 A.U2746 A.A2802 U-A WC 20-XX cWW cW-W 464 A.U2747 A.A2801 U-A WC 20-XX cWW cW-W 465 A.A2748 A.U2799 A-U WC 20-XX cWW cW-W 466 A.A2749 A.U2799 A-U -- -- cWW cW-W 467 A.U2750 A.A2798 U-A WC 20-XX cWW cW-W 468 A.G2751 A.C2797 G-C WC 19-XIX cWW cW-W 469 A.C2752 A.G2796 C-G WC 19-XIX cWW cW-W 470 A.A2753 A.U2795 A-U WC 20-XX cWW cW-W 471 A.A2754 A.C2793 A-C -- -- cW. cW-. 472 A.U2807 A.A2921 U-A -- -- tSH tm-M 473 A.U2807 A.A2922 U+A -- -- cWH cW+M 474 A.U2808 A.A2922 U+A -- -- cWH cW+M 475 A.C2809 A.G2923 C+G ~Hoogsteen -- cWH cW+M 476 A.C2809 A.U2924 C+U -- -- cWH cW+M 477 A.G2810 A.C2822 G-C WC 19-XIX cWW cW-W 478 A.G2811 A.C2821 G-C WC 19-XIX cWW cW-W 479 A.U2812 A.A2820 U-A WC 20-XX cWW cW-W 480 A.G2819 A.C2839 G-C WC 19-XIX cWW cW-W 481 A.U2823 A.A2845 U-A WC 20-XX cWW cW-W 482 A.C2824 A.G2844 C-G WC 19-XIX cWW cW-W 483 A.G2825 A.C2843 G-C WC 19-XIX cWW cW-W 484 A.G2825 A.A2892 G-A -- -- cSW cm-W 485 A.G2826 A.C2842 G-C WC 19-XIX cWW cW-W 486 A.A2827 A.U2841 A-U WC 20-XX cWW cW-W 487 A.G2828 A.C2840 G-C WC 19-XIX cWW cW-W 488 A.C2829 A.A2838 C-A -- -- cWW cW-W 489 A.A2830 A.A2837 A+A -- 02-II tHH tM+M 490 A.G2844 A.A2893 G+A Linker -- tSS tm+m 491 A.G2846 A.C2915 G-C WC 19-XIX cWW cW-W 492 A.A2848 A.U2890 A-U WC 20-XX cWW cW-W 493 A.G2849 A.C2889 G-C WC 19-XIX cWW cW-W 494 A.U2850 A.U2854 U-U -- -- cWW cW-W 495 A.G2855 A.C2877 G-C WC 19-XIX cWW cW-W 496 A.C2856 A.G2876 C-G WC 19-XIX cWW cW-W 497 A.U2857 A.A2875 U-A -- -- cWW cW-W 498 A.A2858 A.A2874 A-A ~Sheared -- tSH tm-M 499 A.A2859 A.A2873 A-A ~Sheared -- tHS tM-m 500 A.G2860 A.C2872 G-C WC 19-XIX cWW cW-W 501 A.A2861 A.U2871 A-U WC 20-XX cWW cW-W 502 A.C2862 A.G2870 C-G WC 19-XIX cWW cW-W 503 A.U2863 A.A2869 U-A -- -- cWW cW-W 504 A.C2867 A.G2916 C-G WC 19-XIX cWW cW-W 505 A.C2891 A.U2894 C-U -- -- tWH tW-M 506 A.U2895 A.A2913 U+A -- -- cWH cW+M 507 A.G2896 A.A2913 G+A -- -- tHH tM+M 508 A.G2896 A.G2917 G+G -- 04-IV tSS tm+m 509 A.A2897 A.C2912 A-C ~rHoogsteen 25-XXV tHW tM-W 510 A.U2898 A.A2910 U+A -- -- tWW tW+W 511 A.C2899 A.A3301 C-A -- -- cWS cW-m 512 A.C2900 A.G2909 C-G WC 19-XIX cWW cW-W 513 A.A2901 A.U2908 A-U WC 20-XX cWW cW-W 514 A.A2902 A.U2907 A-U WC 20-XX cWW cW-W 515 A.U2903 A.C2906 U-C -- -- tSH tm-M 516 A.G2923 A.A3085 G+A Linker -- tSS tm+m 517 A.U2925 A.C2927 U+C -- -- cSH cm+M 518 A.G2932 A.U2936 G+U -- -- tWW tW+W 519 A.G2933 A.U2936 G+U -- -- tSW tm+W 520 A.G2934 A.A2938 G+A -- -- cWH cW+M 521 A.A2937 A.C2988 A-C ~rHoogsteen 25-XXV tHW tM-W 522 A.A2938 A.U2993 A-U -- -- cSW cm-W 523 A.C2939 A.U2991 C-U -- -- cWW cW-W 524 A.A2940 A.C2986 A-C -- -- cWW cW-W 525 A.G2941 A.G2983 G-G -- -- c.W c.-W 526 A.G2941 A.C2985 G-C WC 19-XIX cWW cW-W 527 A.C2942 A.G2983 C-G WC 19-XIX cWW cW-W 528 A.G2943 A.C2982 G-C WC 19-XIX cWW cW-W 529 A.C2944 A.A2981 C-A ~Wobble -- cWW cW-W 530 A.A2945 A.A2946 A+A Platform -- cSH cm+M 531 A.A2946 A.U2980 A-U WC 20-XX cWW cW-W 532 A.U2947 A.G2977 U-G -- -- c.W c.-W 533 A.U2947 A.U2979 U-U -- 16-XVI cWW cW-W 534 A.C2948 A.G2976 C-G WC 19-XIX cWW cW-W 535 A.C2948 A.U2978 C-U -- -- tSW tm-W 536 A.C2949 A.G2975 C-G WC 19-XIX cWW cW-W 537 A.U2950 A.A2974 U-A WC 20-XX cWW cW-W 538 A.A2951 A.U2973 A-U WC 20-XX cWW cW-W 539 A.U2952 A.A2972 U-A WC 20-XX cWW cW-W 540 A.U2953 A.A2971 U-A WC 20-XX cWW cW-W 541 A.C2954 A.A2969 C-A -- -- tWH tW-M 542 A.C2954 A.C2970 C-C -- -- cWW cW-W 543 A.U2955 A.A2956 U+A Platform -- cWH cW+M 544 A.U2955 A.A2968 U-A WC 20-XX cWW cW-W 545 A.A2956 A.A2968 A-A ~Sheared -- tHS tM-m 546 A.G2957 A.C2967 G-C WC 19-XIX cWW cW-W 547 A.A2958 A.U2966 A-U WC 20-XX cWW cW-W 548 A.G2959 A.A2965 G-A Sheared 11-XI tSH tm-M 549 A.C2962 A.G3016 C+G rWC 22-XXII tWW tW+W 550 A.G2977 A.U2979 G+U -- -- cSH cm+M 551 A.U2987 A.U2991 U+U -- -- cWH cW+M 552 A.U2994 A.G3040 U+G -- -- tWS tW+m 553 A.U2994 A.A3069 U-A WC 20-XX cWW cW-W 554 A.G2995 A.U3067 G-U Wobble 28-XXVIII cWW cW-W 555 A.G2996 A.C3066 G-C WC 19-XIX cWW cW-W 556 A.A2997 A.U3062 A-U -- -- tHW tM-W 557 A.A2997 A.U3065 A-U WC 20-XX cWW cW-W 558 A.U2998 A.U3062 U-U -- 16-XVI cWW cW-W 559 A.C2999 A.G3061 C-G WC 19-XIX cWW cW-W 560 A.A3000 A.U3058 A-U WC 20-XX cWW cW-W 561 A.G3001 A.C3057 G-C WC 19-XIX cWW cW-W 562 A.G3002 A.C3056 G-C WC 19-XIX cWW cW-W 563 A.A3003 A.U3055 A-U WC 20-XX cWW cW-W 564 A.C3004 A.G3054 C-G WC 19-XIX cWW cW-W 565 A.U3006 A.C3008 U+C -- -- cWH cW+M 566 A.C3007 A.A3029 C-A -- -- tHW tM-W 567 A.C3007 A.G3032 C-G WC 19-XIX cWW cW-W 568 A.C3008 A.G3031 C-G WC 19-XIX cWW cW-W 569 A.C3008 A.A3051 C-A -- -- cSS cm-m 570 A.C3009 A.A3028 C+A -- -- cHW cM+W 571 A.G3010 A.U3027 G-U Wobble 28-XXVIII cWW cW-W 572 A.A3011 A.U3026 A-U WC 20-XX cWW cW-W 573 A.U3012 A.A3025 U-A WC 20-XX cWW cW-W 574 A.G3013 A.U3024 G-U Wobble 28-XXVIII cWW cW-W 575 A.G3014 A.C3023 G-C WC 19-XIX cWW cW-W 576 A.U3015 A.G3022 U-G Wobble 28-XXVIII cWW cW-W 577 A.A3018 A.C3126 A-C -- -- cSS cm-m 578 A.A3018 A.A3130 A+A -- 01-I tWW tW+W 579 A.G3031 A.A3051 G+A Linker -- t.W t.+W 580 A.G3032 A.A3052 G+A Linker -- tSS tm+m 581 A.U3033 A.G3054 U+G ~Hoogsteen -- cWH cW+M 582 A.U3034 A.A3048 U-A WC 20-XX cWW cW-W 583 A.C3035 A.G3047 C-G WC 19-XIX cWW cW-W 584 A.G3036 A.C3046 G-C WC 19-XIX cWW cW-W 585 A.U3037 A.A3045 U-A WC 20-XX cWW cW-W 586 A.U3038 A.A3044 U-A WC 20-XX cWW cW-W 587 A.U3039 A.C3043 U-C -- -- t.H t.-M 588 A.U3049 A.A3053 U-A rHoogsteen 24-XXIV tWH tW-M 589 A.U3050 A.A3052 U-A -- -- tSH tm-M 590 A.U3067 A.A3069 U+A -- -- cWH cW+M 591 A.A3074 A.G3095 A-G Sheared 11-XI tHS tM-m 592 A.G3075 A.C3093 G-C WC 19-XIX cWW cW-W 593 A.A3076 A.U3092 A-U WC 20-XX cWW cW-W 594 A.C3077 A.G3091 C-G WC 19-XIX cWW cW-W 595 A.C3078 A.G3090 C-G WC 19-XIX cWW cW-W 596 A.G3079 A.C3088 G-C WC 19-XIX cWW cW-W 597 A.G3080 A.C3087 G-C WC 19-XIX cWW cW-W 598 A.A3081 A.U3086 A-U WC 20-XX cWW cW-W 599 A.G3082 A.A3085 G-A Sheared 11-XI tSH tm-M 600 A.A3101 A.C3103 A+C -- -- cSH cm+M 601 A.A3113 A.U3143 A-U WC 20-XX cWW cW-W 602 A.U3114 A.A3142 U-A WC 20-XX cWW cW-W 603 A.U3115 A.A3141 U-A WC 20-XX cWW cW-W 604 A.C3116 A.A3140 C-A ~Wobble -- cWW cW-W 605 A.C3117 A.G3139 C-G WC 19-XIX cWW cW-W 606 A.U3118 A.A3138 U-A WC 20-XX cWW cW-W 607 A.C3119 A.G3137 C-G WC 19-XIX cWW cW-W 608 A.C3120 A.A3136 C-A ~Wobble -- cWW cW-W 609 A.C3121 A.A3135 C-A -- -- tWH tW-M 610 A.U3124 A.A3133 U-A rHoogsteen 24-XXIV tWH tW-M 611 A.A3125 A.G3132 A-G Sheared 11-XI tHS tM-m 612 A.C3126 A.G3131 C-G WC 19-XIX cWW cW-W 613 A.G3127 A.A3130 G-A Sheared 11-XI tSH tm-M 614 A.A3144 A.U3167 A-U WC 20-XX cWW cW-W 615 A.A3145 A.U3166 A-U WC 20-XX cWW cW-W 616 A.G3146 A.C3165 G-C WC 19-XIX cWW cW-W 617 A.G3147 A.C3164 G-C WC 19-XIX cWW cW-W 618 A.C3148 A.G3163 C-G WC 19-XIX cWW cW-W 619 A.C3149 A.A3151 C-A -- -- cSW cm-W 620 A.C3149 A.G3161 C-G ~rHoogsteen -- tWH tW-M 621 A.U3150 A.G3163 U-G -- -- cWS cW-m 622 A.A3151 A.G3163 A+G -- -- cHS cM+m 623 A.C3152 A.G3161 C-G WC 19-XIX cWW cW-W 624 A.U3153 A.A3160 U-A WC 20-XX cWW cW-W 625 A.U3154 A.A3159 U-A WC 20-XX cWW cW-W 626 A.C3155 A.A3158 C+A -- -- tSW tm+W 627 A.G3173 A.G3196 G-G -- -- tHW tM-W 628 A.U3174 A.A3195 U-A WC 20-XX cWW cW-W 629 A.A3175 A.U3194 A-U WC 20-XX cWW cW-W 630 A.A3176 A.U3193 A-U WC 20-XX cWW cW-W 631 A.A3177 A.C3192 A-C ~Wobble -- cWW cW-W 632 A.U3178 A.U3188 U-U Calcutta -- tWH tW-M 633 A.G3179 A.A3190 G-A Sheared 11-XI tSH tm-M 634 A.A3180 A.U3186 A-U rHoogsteen 24-XXIV tHW tM-W 635 A.U3181 A.A3185 U-A -- -- tHW tM-W 636 A.U3188 A.A3191 U+A -- -- cWH cW+M 637 A.A3213 A.U3227 A-U WC 20-XX cWW cW-W 638 A.C3214 A.G3226 C-G WC 19-XIX cWW cW-W 639 A.C3215 A.G3225 C-G WC 19-XIX cWW cW-W 640 A.C3216 A.G3224 C-G WC 19-XIX cWW cW-W 641 A.A3218 A.A3223 A-A -- -- cSW cm-W 642 B.C1601 B.G1669 C-G WC 19-XIX cWW cW-W 643 B.A1603 B.U1668 A-U WC 20-XX cWW cW-W 644 B.G1604 B.C1667 G-C WC 19-XIX cWW cW-W 645 B.A1605 B.U1666 A-U WC 20-XX cWW cW-W 646 B.G1606 B.C1665 G-C WC 19-XIX cWW cW-W 647 B.U1607 B.G1664 U-G Wobble 28-XXVIII cWW cW-W 648 B.G1608 B.C1663 G-C WC 19-XIX cWW cW-W 649 B.A1610 B.C1612 A-C -- -- cHH cM-M 650 B.A1610 B.G1623 A+G Linker -- tHH tM+M 651 B.G1611 B.C1624 G-C WC 19-XIX cWW cW-W 652 B.G1611 B.G1644 G+G -- 06-VI cHW cM+W 653 B.C1612 B.G1623 C-G WC 19-XIX cWW cW-W 654 B.U1613 B.A1622 U-A WC 20-XX cWW cW-W 655 B.A1615 B.A1621 A-A -- -- cWS cW-m 656 B.A1616 B.U1646 A+U rWC 21-XXI tWW tW+W 657 B.A1622 B.A1645 A-A -- 05-V tHW tM-W 658 B.C1624 B.G1644 C-G -- -- c.W c.-W 659 B.A1625 B.A1643 A-A -- -- cWW cW-W 660 B.C1626 B.G1642 C-G WC 19-XIX cWW cW-W 661 B.C1627 B.G1641 C-G WC 19-XIX cWW cW-W 662 B.C1628 B.A1640 C-A ~Wobble -- cWW cW-W 663 B.A1629 B.U1639 A-U WC 20-XX cWW cW-W 664 B.A1630 B.U1638 A-U WC 20-XX cWW cW-W 665 B.C1631 B.A1636 C-A -- -- tWH tW-M 666 B.C1631 B.C1637 C-C -- -- cWW cW-W 667 B.U1632 B.C1635 U-C -- -- tWH tW-M 668 B.U1648 B.A1661 U-A WC 20-XX cWW cW-W 669 B.C1649 B.G1660 C-G WC 19-XIX cWW cW-W 670 B.A1650 B.U1659 A-U WC 20-XX cWW cW-W 671 B.A1651 B.U1658 A-U WC 20-XX cWW cW-W **************************************************************************** List of 104 multiplets 1 nts=3 AAA A.A1680,A.A1772,A.A1775 2 nts=3 GCG A.G1681,A.C1771,A.G1776 3 nts=3 ACG A.A1718,A.C1911,A.G2008 4 nts=3 GCG A.G1719,A.C1910,A.G2009 5 nts=3 CAU A.C1720,A.A1909,A.U2010 6 nts=3 AUG A.A1723,A.U1728,A.G1750 7 nts=3 AUG A.A1724,A.U2035,A.G2040 8 nts=3 UUG A.U1738,A.U1759,A.G1888 9 nts=3 GUA A.G1742,A.U1743,A.A1755 10 nts=3 CCG A.C1769,A.C2276,A.G2289 11 nts=3 UAA A.U1778,A.A1781,A.A1795 12 nts=3 GUA A.G1782,A.U1783,A.A1794 13 nts=3 ACG A.A1789,A.C1915,A.G2004 14 nts=3 UAU A.U1799,A.A1803,A.U1807 15 nts=3 ACG A.A1828,A.C2683,A.G2697 16 nts=3 UUA A.U1843,A.U2691,A.A2696 17 nts=3 CGA A.C1845,A.G1858,A.A2297 18 nts=3 CUA A.C1905,A.U2017,A.A2723 19 nts=3 GGC A.G1916,A.G1985,A.C2001 20 nts=3 GCU A.G1939,A.C2494,A.U2510 21 nts=3 CGA A.C1948,A.G1968,A.A2644 22 nts=3 GUU A.G1949,A.U1950,A.U1967 23 nts=3 UCA A.U1954,A.C1959,A.A1963 24 nts=3 AUA A.A1974,A.U2495,A.A2509 25 nts=3 AGC A.A1984,A.G1987,A.C1997 26 nts=3 AGC A.A1991,A.G2496,A.C2508 27 nts=3 AUU A.A2033,A.U2042,A.U2096 28 nts=3 AUA A.A2064,A.U2075,A.A2833 29 nts=3 UAA A.U2099,A.A2122,A.A2135 30 nts=3 GCG A.G2107,A.C2114,A.G2814 31 nts=3 AUA A.A2127,A.U2138,A.A2151 32 nts=3 ACG A.A2131,A.C2689,A.G2700 33 nts=3 AGC A.A2132,A.G2690,A.C2699 34 nts=3 GGC A.G2182,A.G2201,A.C2210 35 nts=3 CCG A.C2183,A.C2202,A.G2209 36 nts=3 AAU A.A2199,A.A2200,A.U2211 37 nts=3 AAU A.A2229,A.A2951,A.U2973 38 nts=3 AUA A.A2230,A.U2950,A.A2974 39 nts=3 AAU A.A2231,A.A3003,A.U3055 40 nts=3 AGC A.A2232,A.G3002,A.C3056 41 nts=3 AGC A.A2315,A.G2453,A.C2671 42 nts=3 CGA A.C2328,A.G2449,A.A2451 43 nts=3 AGC A.A2468,A.G2655,A.C2659 44 nts=3 GAU A.G2471,A.A2473,A.U2656 45 nts=3 AAU A.A2472,A.A2480,A.U2654 46 nts=3 GAC A.G2478,A.A2482,A.C2653 47 nts=3 CGA A.C2520,A.G2528,A.A2530 48 nts=3 CGA A.C2548,A.G2567,A.A2590 49 nts=3 CUA A.C2549,A.U2552,A.A2565 50 nts=3 GUC A.G2551,A.U2563,A.C2566 51 nts=3 ACG A.A2615,A.C3035,A.G3047 52 nts=3 AGC A.A2616,A.G3036,A.C3046 53 nts=3 ACG A.A2694,A.C2942,A.G2983 54 nts=3 AAU A.A2714,A.A2715,A.U3104 55 nts=3 GAC A.G2716,A.A3101,A.C3103 56 nts=3 AAU A.A2717,A.A3064,A.U3102 57 nts=3 CAC A.C2726,A.A2937,A.C2988 58 nts=3 CGU A.C2727,A.G2933,A.U2936 59 nts=3 AUC A.A2734,A.U2925,A.C2927 60 nts=3 CGA A.C2824,A.G2844,A.A2893 61 nts=3 GCA A.G2825,A.C2843,A.A2892 62 nts=3 CUU A.C2939,A.U2987,A.U2991 63 nts=3* GGC A.G2941,A.G2983,A.C2985 64 nts=3 AAU A.A2945,A.A2946,A.U2980 65 nts=3 UGU A.U2947,A.G2977,A.U2979 66 nts=3 CGU A.C2948,A.G2976,A.U2978 67 nts=3 UAA A.U2955,A.A2956,A.A2968 68 nts=3 AUU A.A2997,A.U3062,A.U3065 69 nts=3 CUG A.C3004,A.U3033,A.G3054 70 nts=3 ACG A.A3018,A.C3126,A.G3131 71 nts=3 AGA A.A3018,A.G3127,A.A3130 72 nts=3 CUG A.C3148,A.U3150,A.G3163 73 nts=3 CCG A.C3149,A.C3152,A.G3161 74 nts=3 UUA A.U3178,A.U3188,A.A3191 75 nts=3 ACG B.A1610,B.C1612,B.G1623 76 nts=3 GCG B.G1611,B.C1624,B.G1644 77 nts=3 UAA B.U1613,B.A1622,B.A1645 78 nts=4 UAUG A.U1673,A.A1815,A.U1861,A.G2304 79 nts=4 AUGA A.A1722,A.U1729,A.G1747,A.A1751 80 nts=4 GAAC A.G1787,A.A1790,A.A1914,A.C2005 81 nts=4 UGCA A.U1850,A.G2098,A.C2123,A.A2134 82 nts=4 UCGA A.U1866,A.C1904,A.G2018,A.A2298 83 nts=4 ACGC A.A1867,A.C1903,A.G2019,A.C2295 84 nts=4 AUAU A.A1907,A.U2013,A.A2730,A.U2930 85 nts=4 AAGC A.A1908,A.A2012,A.G2732,A.C2929 86 nts=4 AUGC A.A1917,A.U1920,A.G1988,A.C1996 87 nts=4 GGCU A.G2002,A.G2735,A.C2809,A.U2924 88 nts=4 GCAA A.G2105,A.C2116,A.A2830,A.A2837 89 nts=4 GAGC A.G2108,A.A2112,A.G2943,A.C2982 90 nts=4 GCAG A.G2128,A.C2137,A.A2152,A.G2249 91 nts=4 GUAU A.G2310,A.U2311,A.A2676,A.U3100 92 nts=4 CGUA A.C2513,A.G2537,A.U2545,A.A2633 93 nts=4 CGAA A.C2547,A.G2568,A.A2589,A.A2591 94 nts=4 GGAU A.G2724,A.G2934,A.A2938,A.U2993 95 nts=4 UUAA A.U2737,A.U2807,A.A2921,A.A2922 96 nts=4 UAUA A.U2738,A.A2740,A.U2807,A.A2921 97 nts=4 UGAG A.U2895,A.G2896,A.A2913,A.G2917 98 nts=4 UGUA A.U2994,A.G3040,A.U3067,A.A3069 99 nts=4 UCGA A.U3006,A.C3008,A.G3031,A.A3051 100 nts=4 CCAG A.C3148,A.C3149,A.A3151,A.G3163 101 nts=5 AACGU A.A2039,A.A2097,A.C2728,A.G2932,A.U2936 102 nts=5 CGUAG A.C2544,A.G2593,A.U2594,A.A2632,A.G2635 103 nts=5 CCGGA A.C2736,A.C2809,A.G2923,A.G3082,A.A3085 104 nts=5 CAGUA A.C3007,A.A3029,A.G3032,A.U3050,A.A3052 **************************************************************************** List of 54 helices Note: a helix is defined by base-stacking interactions, regardless of bp type and backbone connectivity, and may contain more than one stem. helix#number[stems-contained] bps=number-of-base-pairs in the helix bp-type: '|' for a canonical WC/wobble pair, '.' otherwise helix-form: classification of a dinucleotide step comprising the bp above the given designation and the bp that follows it. Types include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices, '.' for an unclassified step, and 'x' for a step without a continuous backbone. -------------------------------------------------------------------- helix#1[1] bps=3 strand-1 5'-GCU-3' bp-type ||. strand-2 3'-CGA-5' helix-form .. 1 A.G1671 A.C1817 G-C WC 19-XIX cWW cW-W 2 A.C1672 A.G1816 C-G WC 19-XIX cWW cW-W 3 A.U1673 A.A1815 U-A -- -- cWH cW-M -------------------------------------------------------------------------- helix#2[2] bps=7 strand-1 5'-CUAGCCC-3' bp-type |..|||| strand-2 3'-GAACGGG-5' helix-form xxxAxA 1 A.C1678 A.G1797 C-G WC 19-XIX cWW cW-W 2 A.U1679 A.A1773 U-A rHoogsteen 24-XXIV tWH tW-M 3 A.A1680 A.A1775 A+A -- 01-I tWW tW+W 4 A.G1681 A.C1771 G-C WC 19-XIX cWW cW-W 5 A.C1682 A.G1770 C-G WC 19-XIX cWW cW-W 6 A.C1683 A.G1768 C-G WC 19-XIX cWW cW-W 7 A.C1684 A.G1767 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#3[0] bps=2 strand-1 5'-CA-3' bp-type .| strand-2 3'-UU-5' helix-form . 1 A.C1721 A.U1730 C-U -- 18-XVIII cWW cW-W 2 A.A1722 A.U1729 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- helix#4[1] bps=11 strand-1 5'-AUAAAUAUAGU-3' bp-type ..|....||.. strand-2 3'-GUUAAAGAUAG-5' helix-form ....x..A.x 1 A.A1737 A.G1760 A-G Sheared 11-XI tHS tM-m 2 A.U1738 A.U1759 U-U -- 16-XVI cWW cW-W 3 A.A1739 A.U1758 A-U WC 20-XX cWW cW-W 4 A.A1740 A.A1757 A-A ~Sheared -- tSH tm-M 5 A.A1741 A.A1756 A+A -- 02-II tHH tM+M 6 A.U1743 A.A1755 U-A rHoogsteen 24-XXIV tWH tW-M 7 A.A1744 A.G1754 A-G Sheared 11-XI tHS tM-m 8 A.U1745 A.A1753 U-A WC 20-XX cWW cW-W 9 A.A1746 A.U1752 A-U WC 20-XX cWW cW-W 10 A.G1747 A.A1751 G-A Sheared 11-XI tSH tm-M 11 A.U1728 A.G1750 U+G rWobble 27-XXVII tWW tW+W -------------------------------------------------------------------------- helix#5[1] bps=6 strand-1 5'-AUACCG-3' bp-type ...||. strand-2 3'-AAGGGA-5' helix-form x..A. 1 A.A1781 A.A1795 A+A -- 02-II tHH tM+M 2 A.U1783 A.A1794 U-A rHoogsteen 24-XXIV tWH tW-M 3 A.A1784 A.G1793 A-G Sheared 11-XI tHS tM-m 4 A.C1785 A.G1792 C-G WC 19-XIX cWW cW-W 5 A.C1786 A.G1791 C-G WC 19-XIX cWW cW-W 6 A.G1787 A.A1790 G-A Sheared 11-XI tSH tm-M -------------------------------------------------------------------------- helix#6[1] bps=7 strand-1 5'-AGGCCCG-3' bp-type ..||||| strand-2 3'-UACGGGC-5' helix-form .xAAAA 1 A.A1825 A.U2705 A+U Hoogsteen 23-XXIII cHW cM+W 2 A.G1826 A.A2704 G-A Imino 08-VIII cWW cW-W 3 A.G2686 A.C2703 G-C WC 19-XIX cWW cW-W 4 A.C2687 A.G2702 C-G WC 19-XIX cWW cW-W 5 A.C2688 A.G2701 C-G WC 19-XIX cWW cW-W 6 A.C2689 A.G2700 C-G WC 19-XIX cWW cW-W 7 A.G2690 A.C2699 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#7[1] bps=3 strand-1 5'-AGG-3' bp-type ||| strand-2 3'-UCC-5' helix-form AA 1 A.A1829 A.U1841 A-U WC 20-XX cWW cW-W 2 A.G1830 A.C1840 G-C WC 19-XIX cWW cW-W 3 A.G1831 A.C1839 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#8[3] bps=19 strand-1 5'-GCCCGAAACCAGACGGGCG-3' bp-type .||.|...||||.||||.. strand-2 3'-UGGUCUAUGGUCCGCCCAA-5' helix-form xAA.x.x.AAA..xxA.x 1 A.G1868 A.U2020 G-U -- -- cWW cW-W 2 A.C1903 A.G2019 C-G WC 19-XIX cWW cW-W 3 A.C1904 A.G2018 C-G WC 19-XIX cWW cW-W 4 A.C1905 A.U2017 C-U -- -- cWW cW-W 5 A.G1906 A.C2016 G-C WC 19-XIX cWW cW-W 6 A.A1907 A.U2013 A-U rHoogsteen 24-XXIV tHW tM-W 7 A.A1908 A.A2012 A-A -- 05-V tHW tM-W 8 A.A1909 A.U2010 A+U -- -- tWW tW+W 9 A.C1910 A.G2009 C-G WC 19-XIX cWW cW-W 10 A.C1911 A.G2008 C-G WC 19-XIX cWW cW-W 11 A.A1912 A.U2007 A-U WC 20-XX cWW cW-W 12 A.G1913 A.C2006 G-C WC 19-XIX cWW cW-W 13 A.A1914 A.C2005 A-C ~Wobble -- cWW cW-W 14 A.C1915 A.G2004 C-G WC 19-XIX cWW cW-W 15 A.G1985 A.C2001 G-C WC 19-XIX cWW cW-W 16 A.G1987 A.C1997 G-C WC 19-XIX cWW cW-W 17 A.G1988 A.C1996 G-C WC 19-XIX cWW cW-W 18 A.C1989 A.A1995 C-A -- -- cWW cW-W 19 A.G1990 A.A1993 G+A -- 10-X tSW tm+W -------------------------------------------------------------------------- helix#9[1] bps=6 strand-1 5'-ACUUGC-3' bp-type .||.|| strand-2 3'-AGAUCG-5' helix-form xxx.A 1 A.A1873 A.A1900 A-A -- -- c.W c.-W 2 A.C1875 A.G1899 C-G WC 19-XIX cWW cW-W 3 A.U1876 A.A1897 U-A WC 20-XX cWW cW-W 4 A.U1878 A.U1896 U-U -- -- cWW cW-W 5 A.G1879 A.C1895 G-C WC 19-XIX cWW cW-W 6 A.C1880 A.G1894 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#10[1] bps=3 strand-1 5'-AGG-3' bp-type .|| strand-2 3'-ACC-5' helix-form .A 1 A.A1882 A.A1891 A+A -- -- tWS tW+m 2 A.G1883 A.C1890 G-C WC 19-XIX cWW cW-W 3 A.G1884 A.C1889 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#11[2] bps=12 strand-1 5'-CUACCUAAGAAC-3' bp-type ..|||||.|||| strand-2 3'-AAUGGAUAUUUG-5' helix-form xxAAAA...Ax 1 A.C1919 A.A2500 C-A -- -- cSW cm-W 2 A.U1920 A.A1917 U+A -- -- tWS tW+m 3 A.A1921 A.U1983 A-U WC 20-XX cWW cW-W 4 A.C1922 A.G1982 C-G WC 19-XIX cWW cW-W 5 A.C1923 A.G1981 C-G WC 19-XIX cWW cW-W 6 A.U1924 A.A1980 U-A WC 20-XX cWW cW-W 7 A.A1925 A.U1979 A-U WC 20-XX cWW cW-W 8 A.A1926 A.A1978 A-A -- -- cWW cW-W 9 A.G1927 A.U1977 G-U Wobble 28-XXVIII cWW cW-W 10 A.A1928 A.U1976 A-U WC 20-XX cWW cW-W 11 A.A1929 A.U1975 A-U WC 20-XX cWW cW-W 12 A.C1930 A.G1973 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#12[3] bps=15 strand-1 5'-AAGCAACCCUCUAUG-3' bp-type .|||..|||.||||. strand-2 3'-AUCGAAGGGUGAUAA-5' helix-form xAA.x.AAx.AAAx 1 A.A1938 A.A1935 A+A -- -- tWS tW+m 2 A.A1940 A.U1934 A-U WC 20-XX cWW cW-W 3 A.G1941 A.C1933 G-C WC 19-XIX cWW cW-W 4 A.C1942 A.G1932 C-G WC 19-XIX cWW cW-W 5 A.A1943 A.A1931 A-A ~Sheared -- tSH tm-M 6 A.A1945 A.A1971 A-A ~Sheared -- tHS tM-m 7 A.C1946 A.G1970 C-G WC 19-XIX cWW cW-W 8 A.C1947 A.G1969 C-G WC 19-XIX cWW cW-W 9 A.C1948 A.G1968 C-G WC 19-XIX cWW cW-W 10 A.U1950 A.U1967 U-U -- 16-XVI cWW cW-W 11 A.C1951 A.G1966 C-G WC 19-XIX cWW cW-W 12 A.U1952 A.A1965 U-A WC 20-XX cWW cW-W 13 A.A1953 A.U1964 A-U WC 20-XX cWW cW-W 14 A.U1954 A.A1963 U-A WC 20-XX cWW cW-W 15 A.G1955 A.A1960 G+A -- 10-X tSW tm+W -------------------------------------------------------------------------- helix#13[0] bps=3 strand-1 5'-UAU-3' bp-type ||. strand-2 5'-GUU-3' helix-form xx 1 A.U2035 A.G2040 U-G Wobble 28-XXVIII cWW cW-W 2 A.A2033 A.U2041 A-U WC 20-XX cWW cW-W 3 A.U2096 A.U2042 U+U -- -- tHH tM+M -------------------------------------------------------------------------- helix#14[2] bps=12 strand-1 5'-CAACUUUAAAUU-3' bp-type |.||.||||||| strand-2 3'-GAUGCAAUUUAA-5' helix-form .x.x.AAAA.. 1 A.C2043 A.G2032 C-G WC 19-XIX cWW cW-W 2 A.A2044 A.A2031 A-A ~Sheared -- tSH tm-M 3 A.A2045 A.U2095 A-U WC 20-XX cWW cW-W 4 A.C2046 A.G2094 C-G WC 19-XIX cWW cW-W 5 A.U2047 A.C2092 U-C -- -- cWW cW-W 6 A.U2048 A.A2091 U-A WC 20-XX cWW cW-W 7 A.U2049 A.A2090 U-A WC 20-XX cWW cW-W 8 A.A2050 A.U2089 A-U WC 20-XX cWW cW-W 9 A.A2051 A.U2088 A-U WC 20-XX cWW cW-W 10 A.A2052 A.U2087 A-U WC 20-XX cWW cW-W 11 A.U2053 A.A2086 U-A WC 20-XX cWW cW-W 12 A.U2054 A.A2085 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- helix#15[2] bps=9 strand-1 5'-UGCCCAAGA-3' bp-type |||....|| strand-2 3'-AUGUCCCCU-5' helix-form ...x.x.A 1 A.U2055 A.A2084 U-A WC 20-XX cWW cW-W 2 A.G2056 A.U2083 G-U Wobble 28-XXVIII cWW cW-W 3 A.C2057 A.G2082 C-G WC 19-XIX cWW cW-W 4 A.C2058 A.U2081 C-U -- 18-XVIII cWW cW-W 5 A.C2059 A.C2079 C+C -- -- tSW tm+W 6 A.A2060 A.C2078 A-C -- -- tHS tM-m 7 A.A2062 A.C2077 A-C -- -- cWW cW-W 8 A.G2063 A.C2076 G-C WC 19-XIX cWW cW-W 9 A.A2064 A.U2075 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- helix#16[1] bps=11 strand-1 5'-GUCCAAAGAGG-3' bp-type ||||||||||. strand-2 3'-CAGGUUUCUCA-5' helix-form .AAAAA.AAx 1 A.G2098 A.C2123 G-C WC 19-XIX cWW cW-W 2 A.U2099 A.A2122 U-A WC 20-XX cWW cW-W 3 A.C2100 A.G2121 C-G WC 19-XIX cWW cW-W 4 A.C2101 A.G2120 C-G WC 19-XIX cWW cW-W 5 A.A2102 A.U2119 A-U WC 20-XX cWW cW-W 6 A.A2103 A.U2118 A-U WC 20-XX cWW cW-W 7 A.A2104 A.U2117 A-U WC 20-XX cWW cW-W 8 A.G2105 A.C2116 G-C WC 19-XIX cWW cW-W 9 A.A2106 A.U2115 A-U WC 20-XX cWW cW-W 10 A.G2107 A.C2114 G-C WC 19-XIX cWW cW-W 11 A.G2108 A.A2112 G-A Sheared 11-XI tSH tm-M -------------------------------------------------------------------------- helix#17[1] bps=3 strand-1 5'-AGG-3' bp-type ||| strand-2 3'-UCC-5' helix-form AA 1 A.A2127 A.U2138 A-U WC 20-XX cWW cW-W 2 A.G2128 A.C2137 G-C WC 19-XIX cWW cW-W 3 A.G2129 A.C2136 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#18[2] bps=9 strand-1 5'-GAGGAGUAA-3' bp-type ||||||..| strand-2 3'-CUCCUCAGU-5' helix-form AAxAAxx. 1 A.G2143 A.C2257 G-C WC 19-XIX cWW cW-W 2 A.A2144 A.U2256 A-U WC 20-XX cWW cW-W 3 A.G2145 A.C2255 G-C WC 19-XIX cWW cW-W 4 A.G2147 A.C2254 G-C WC 19-XIX cWW cW-W 5 A.A2148 A.U2253 A-U WC 20-XX cWW cW-W 6 A.G2149 A.C2252 G-C WC 19-XIX cWW cW-W 7 A.U2150 A.A2250 U-A rHoogsteen 24-XXIV tWH tW-M 8 A.A2152 A.G2249 A-G Sheared 11-XI tHS tM-m 9 A.A2153 A.U2248 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- helix#19[1] bps=9 strand-1 5'-CCAGAGCGU-3' bp-type ...||||.. strand-2 3'-CAACUCGAA-5' helix-form ..xx.... 1 A.C2165 A.C2215 C-C -- -- tW. tW-. 2 A.C2166 A.A2214 C-A -- -- t.H t.-M 3 A.A2167 A.A2213 A-A -- -- tWH tW-M 4 A.G2197 A.C2212 G-C WC 19-XIX cWW cW-W 5 A.A2200 A.U2211 A-U WC 20-XX cWW cW-W 6 A.G2201 A.C2210 G-C WC 19-XIX cWW cW-W 7 A.C2202 A.G2209 C-G WC 19-XIX cWW cW-W 8 A.G2203 A.A2208 G-A Sheared 11-XI tSH tm-M 9 A.U2204 A.A2207 U-A -- -- tSH tm-M -------------------------------------------------------------------------- helix#20[0] bps=2 strand-1 5'-UG-3' bp-type || strand-2 5'-AC-3' helix-form x 1 A.U2168 A.A2192 U-A WC 20-XX cWW cW-W 2 A.G2170 A.C2190 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#21[1] bps=5 strand-1 5'-GGCCU-3' bp-type |||.. strand-2 3'-CCGAA-5' helix-form ...x 1 A.G2173 A.C2187 G-C WC 19-XIX cWW cW-W 2 A.G2174 A.C2186 G-C WC 19-XIX cWW cW-W 3 A.C2175 A.G2185 C-G WC 19-XIX cWW cW-W 4 A.C2176 A.A2184 C-A -- -- cWW cW-W 5 A.U2177 A.A2180 U-A -- -- tSH tm-M -------------------------------------------------------------------------- helix#22[2] bps=17 strand-1 5'-AAUUGGACCAAUCUAUC-3' bp-type ..||||||...|||||. strand-2 3'-CGAACCUGAAAAGAUAU-5' helix-form x.AAAA.x.x...A.. 1 A.A2264 A.C2263 A+C Platform -- cHW cM+W 2 A.A2265 A.G2028 A-G Sheared 11-XI tHS tM-m 3 A.U2266 A.A2027 U-A WC 20-XX cWW cW-W 4 A.U2267 A.A2026 U-A WC 20-XX cWW cW-W 5 A.G2268 A.C2025 G-C WC 19-XIX cWW cW-W 6 A.G2269 A.C2024 G-C WC 19-XIX cWW cW-W 7 A.A2270 A.U2023 A-U WC 20-XX cWW cW-W 8 A.C2271 A.G2022 C-G WC 19-XIX cWW cW-W 9 A.C2272 A.A2294 C-A -- -- cWW cW-W 10 A.A2273 A.A2293 A-A -- -- cWS cW-m 11 A.A2274 A.A2291 A+A -- -- cHW cM+W 12 A.U2275 A.A2290 U-A WC 20-XX cWW cW-W 13 A.C2276 A.G2289 C-G WC 19-XIX cWW cW-W 14 A.U2277 A.A2288 U-A WC 20-XX cWW cW-W 15 A.A2278 A.U2287 A-U WC 20-XX cWW cW-W 16 A.U2279 A.A2286 U-A WC 20-XX cWW cW-W 17 A.C2280 A.U2285 C-U -- 18-XVIII cWW cW-W -------------------------------------------------------------------------- helix#23[4] bps=27 strand-1 5'-CAGUAGUAUAAUAACAGGUUAAAAGUA-3' bp-type ..||||||.....||.||||.|||||| strand-2 3'-AUCAUUAUUAAAGUGACCAAUUUUCAU-5' helix-form xxxx..x...x..A.xAA.x.AAAAx 1 A.C2295 A.A1867 C+A -- -- tHH tM+M 2 A.A2298 A.U1866 A-U -- -- tH. tM-. 3 A.G2300 A.C1865 G-C WC 19-XIX cWW cW-W 4 A.U2301 A.A1863 U-A WC 20-XX cWW cW-W 5 A.A2303 A.U1862 A-U WC 20-XX cWW cW-W 6 A.G2304 A.U1861 G-U Wobble 28-XXVIII cWW cW-W 7 A.U2305 A.A1860 U-A WC 20-XX cWW cW-W 8 A.A2306 A.U2680 A-U WC 20-XX cWW cW-W 9 A.U2307 A.U2679 U-U -- 16-XVI cWW cW-W 10 A.A2308 A.A2678 A-A ~Sheared -- tSH tm-M 11 A.A2309 A.A2677 A+A -- 02-II tHH tM+M 12 A.U2311 A.A2676 U-A rHoogsteen 24-XXIV tWH tW-M 13 A.A2312 A.G2675 A-G Sheared 11-XI tHS tM-m 14 A.A2313 A.U2674 A-U WC 20-XX cWW cW-W 15 A.C2314 A.G2673 C-G WC 19-XIX cWW cW-W 16 A.A2315 A.A2672 A+A -- -- cHW cM+W 17 A.G2453 A.C2671 G-C WC 19-XIX cWW cW-W 18 A.G2454 A.C2670 G-C WC 19-XIX cWW cW-W 19 A.U2455 A.A2669 U-A WC 20-XX cWW cW-W 20 A.U2456 A.A2668 U-A WC 20-XX cWW cW-W 21 A.A2460 A.U2667 A-U -- -- cWW cW-W 22 A.A2461 A.U2666 A-U WC 20-XX cWW cW-W 23 A.A2462 A.U2665 A-U WC 20-XX cWW cW-W 24 A.A2463 A.U2664 A-U WC 20-XX cWW cW-W 25 A.G2464 A.C2663 G-C WC 19-XIX cWW cW-W 26 A.U2465 A.A2662 U-A WC 20-XX cWW cW-W 27 A.A2466 A.U2660 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- helix#24[2] bps=7 strand-1 5'-UUCUCCU-3' bp-type ||||||. strand-2 3'-AAGAGGA-5' helix-form AAxA.. 1 A.U2324 A.A2319 U-A WC 20-XX cWW cW-W 2 A.U2325 A.A2318 U-A WC 20-XX cWW cW-W 3 A.C2326 A.G2317 C-G WC 19-XIX cWW cW-W 4 A.U2327 A.A2450 U-A WC 20-XX cWW cW-W 5 A.C2328 A.G2449 C-G WC 19-XIX cWW cW-W 6 A.C2329 A.G2448 C-G WC 19-XIX cWW cW-W 7 A.U2330 A.A2447 U+A -- -- cWH cW+M -------------------------------------------------------------------------- helix#25[1] bps=4 strand-1 5'-GCAU-3' bp-type |||| strand-2 3'-CGUA-5' helix-form AAA 1 A.G2333 A.C2441 G-C WC 19-XIX cWW cW-W 2 A.C2334 A.G2440 C-G WC 19-XIX cWW cW-W 3 A.A2335 A.U2439 A-U WC 20-XX cWW cW-W 4 A.U2336 A.A2438 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- helix#26[0] bps=3 strand-1 5'-UGC-3' bp-type .|. strand-2 5'-UCA-3' helix-form xx 1 A.U2342 A.U2371 U+U -- -- tWW tW+W 2 A.G2343 A.C2423 G-C WC 19-XIX cWW cW-W 3 A.C2340 A.A2424 C-A -- -- cWW cW-W -------------------------------------------------------------------------- helix#27[1] bps=5 strand-1 5'-GUCAG-3' bp-type ||||| strand-2 3'-CAGUC-5' helix-form AAA. 1 A.G2345 A.C2368 G-C WC 19-XIX cWW cW-W 2 A.U2346 A.A2367 U-A WC 20-XX cWW cW-W 3 A.C2347 A.G2366 C-G WC 19-XIX cWW cW-W 4 A.A2348 A.U2365 A-U WC 20-XX cWW cW-W 5 A.G2349 A.C2364 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#28[1] bps=5 strand-1 5'-ACAGC-3' bp-type .|||. strand-2 3'-UGUCA-5' helix-form xA.. 1 A.A2373 A.U2422 A-U rHoogsteen 24-XXIV tHW tM-W 2 A.C2375 A.G2421 C-G WC 19-XIX cWW cW-W 3 A.A2376 A.U2420 A-U WC 20-XX cWW cW-W 4 A.G2377 A.C2419 G-C WC 19-XIX cWW cW-W 5 A.C2378 A.A2418 C-A -- -- cWW cW-W -------------------------------------------------------------------------- helix#29[1] bps=5 strand-1 5'-AAUAU-3' bp-type ||||. strand-2 3'-UUAUU-5' helix-form AAA. 1 A.A2381 A.U2411 A-U WC 20-XX cWW cW-W 2 A.A2382 A.U2410 A-U WC 20-XX cWW cW-W 3 A.U2383 A.A2409 U-A WC 20-XX cWW cW-W 4 A.A2384 A.U2408 A-U WC 20-XX cWW cW-W 5 A.U2385 A.U2407 U-U -- 16-XVI cWW cW-W -------------------------------------------------------------------------- helix#30[0] bps=2 strand-1 5'-AG-3' bp-type .| strand-2 5'-AC-3' helix-form x 1 A.A2390 A.A2399 A-A -- 05-V tHW tM-W 2 A.G2403 A.C2400 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#31[1] bps=2 strand-1 5'-CC-3' bp-type || strand-2 3'-GG-5' helix-form . 1 A.C2427 A.G2436 C-G WC 19-XIX cWW cW-W 2 A.C2428 A.G2435 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#32[3] bps=14 strand-1 5'-AAGAAGUUACCCCG-3' bp-type .|||.|..|||||| strand-2 3'-CUCUUCGUUGGGGC-5' helix-form .Axxxxx.AAAxA 1 A.A2468 A.C2659 A+C ~rWobble 26-XXVI tWW tW+W 2 A.A2469 A.U2658 A-U WC 20-XX cWW cW-W 3 A.G2470 A.C2657 G-C WC 19-XIX cWW cW-W 4 A.A2473 A.U2656 A-U WC 20-XX cWW cW-W 5 A.A2472 A.U2654 A-U rHoogsteen 24-XXIV tHW tM-W 6 A.G2478 A.C2653 G-C WC 19-XIX cWW cW-W 7 A.U2483 A.G2652 U-G -- -- cWS cW-m 8 A.U2486 A.U2649 U-U -- 16-XVI cWW cW-W 9 A.A2487 A.U2648 A-U WC 20-XX cWW cW-W 10 A.C2488 A.G2647 C-G WC 19-XIX cWW cW-W 11 A.C2489 A.G2646 C-G WC 19-XIX cWW cW-W 12 A.C2490 A.G2645 C-G WC 19-XIX cWW cW-W 13 A.C2491 A.G2643 C-G WC 19-XIX cWW cW-W 14 A.G2492 A.C2642 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#33[1] bps=6 strand-1 5'-CUGUUU-3' bp-type |.||.. strand-2 3'-GACAAA-5' helix-form xx.x. 1 A.C2494 A.G1939 C-G WC 19-XIX cWW cW-W 2 A.U2495 A.A1974 U+A Hoogsteen 23-XXIII cWH cW+M 3 A.G2496 A.C2508 G-C WC 19-XIX cWW cW-W 4 A.U2497 A.A2507 U-A WC 20-XX cWW cW-W 5 A.U2498 A.A2505 U-A rHoogsteen 24-XXIV tWH tW-M 6 A.U2499 A.A2504 U-A rHoogsteen 24-XXIV tWH tW-M -------------------------------------------------------------------------- helix#34[1] bps=8 strand-1 5'-CACCUCUA-3' bp-type ..|||||| strand-2 3'-ACGGAGAU-5' helix-form ..AAAAA 1 A.C2511 A.A2539 C+A -- -- tWS tW+m 2 A.A2512 A.C2538 A-C ~Wobble -- cWW cW-W 3 A.C2513 A.G2537 C-G WC 19-XIX cWW cW-W 4 A.C2514 A.G2536 C-G WC 19-XIX cWW cW-W 5 A.U2515 A.A2535 U-A WC 20-XX cWW cW-W 6 A.C2516 A.G2534 C-G WC 19-XIX cWW cW-W 7 A.U2517 A.A2533 U-A WC 20-XX cWW cW-W 8 A.A2518 A.U2532 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- helix#35[1] bps=5 strand-1 5'-CGCCU-3' bp-type .|||. strand-2 3'-UCGGA-5' helix-form .A.x 1 A.C2541 A.U2638 C-U -- -- cWW cW-W 2 A.G2542 A.C2637 G-C WC 19-XIX cWW cW-W 3 A.C2543 A.G2636 C-G WC 19-XIX cWW cW-W 4 A.C2544 A.G2635 C-G WC 19-XIX cWW cW-W 5 A.U2545 A.A2633 U+A Hoogsteen 23-XXIII cWH cW+M -------------------------------------------------------------------------- helix#36[4] bps=20 strand-1 5'-UGUUACGGCUAGCUGUUCCU-3' bp-type |||||||||..||.|||||. strand-2 3'-ACAGUGCCGAGUGCCAGGGA-5' helix-form .A.x.xA.x..xxxA..A. 1 A.U2559 A.A2556 U-A WC 20-XX cWW cW-W 2 A.G2560 A.C2555 G-C WC 19-XIX cWW cW-W 3 A.U2561 A.A2554 U-A WC 20-XX cWW cW-W 4 A.U2562 A.G2553 U-G Wobble 28-XXVIII cWW cW-W 5 A.A2565 A.U2552 A-U WC 20-XX cWW cW-W 6 A.C2566 A.G2551 C-G WC 19-XIX cWW cW-W 7 A.G2567 A.C2548 G-C WC 19-XIX cWW cW-W 8 A.G2568 A.C2547 G-C WC 19-XIX cWW cW-W 9 A.C2569 A.G2546 C-G WC 19-XIX cWW cW-W 10 A.U2594 A.A2632 U-A rHoogsteen 24-XXIV tWH tW-M 11 A.A2595 A.G2631 A-G Sheared 11-XI tHS tM-m 12 A.G2596 A.U2630 G-U Wobble 28-XXVIII cWW cW-W 13 A.C2597 A.G2627 C-G WC 19-XIX cWW cW-W 14 A.U2599 A.C2625 U+C -- -- tWW tW+W 15 A.G2608 A.C2624 G-C WC 19-XIX cWW cW-W 16 A.U2609 A.A2623 U-A WC 20-XX cWW cW-W 17 A.U2610 A.G2622 U-G Wobble 28-XXVIII cWW cW-W 18 A.C2611 A.G2621 C-G WC 19-XIX cWW cW-W 19 A.C2612 A.G2620 C-G WC 19-XIX cWW cW-W 20 A.U2613 A.A2619 U-A -- -- cWW cW-W -------------------------------------------------------------------------- helix#37[1] bps=8 strand-1 5'-ACCGUGCA-3' bp-type .|||||.. strand-2 3'-UGGCGCGA-5' helix-form .AA..x. 1 A.A2582 A.U2575 A-U -- -- tHW tM-W 2 A.C2583 A.G2574 C-G WC 19-XIX cWW cW-W 3 A.C2584 A.G2573 C-G WC 19-XIX cWW cW-W 4 A.G2585 A.C2572 G-C WC 19-XIX cWW cW-W 5 A.U2586 A.G2571 U-G Wobble 28-XXVIII cWW cW-W 6 A.G2587 A.C2570 G-C WC 19-XIX cWW cW-W 7 A.C2588 A.G2592 C+G rWC 22-XXII tWW tW+W 8 A.A2589 A.A2591 A-A -- -- tSH tm-M -------------------------------------------------------------------------- helix#38[0] bps=8 strand-1 5'-AAUGAGAC-3' bp-type .|.|.|.| strand-2 3'-CUCCACGG-5' helix-form x...xx. 1 A.A2693 A.C1849 A-C -- -- tH. tM-. 2 A.A1856 A.U1847 A-U WC 20-XX cWW cW-W 3 A.U1857 A.C1846 U-C -- 18-XVIII cWW cW-W 4 A.G1858 A.C1845 G-C WC 19-XIX cWW cW-W 5 A.A1859 A.A1844 A-A -- -- cWW cW-W 6 A.G2681 A.C1827 G-C WC 19-XIX cWW cW-W 7 A.A2682 A.G2698 A-G Imino 08-VIII cWW cW-W 8 A.C2683 A.G2697 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#39[2] bps=6 strand-1 5'-AGCAGA-3' bp-type ||.||| strand-2 3'-UCAUCU-5' helix-form ..xAA 1 A.A2711 A.U3107 A-U WC 20-XX cWW cW-W 2 A.G2712 A.C3106 G-C WC 19-XIX cWW cW-W 3 A.C2713 A.A3105 C-A ~Wobble -- cWW cW-W 4 A.A2715 A.U3104 A-U WC 20-XX cWW cW-W 5 A.G2716 A.C3103 G-C WC 19-XIX cWW cW-W 6 A.A2717 A.U3102 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- helix#40[1] bps=2 strand-1 5'-GA-3' bp-type || strand-2 3'-CU-5' helix-form A 1 A.G2719 A.C3099 G-C WC 19-XIX cWW cW-W 2 A.A2720 A.U3098 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- helix#41[9] bps=45 strand-1 5'-CUGCAUAAAAAUUAGUUCCUAGGAACAGCGCAUCCUAUUCUGAGG-3' bp-type .||||||||||||||||||||||....|||.|.||||||.|||.. strand-2 3'-AACGUAUUUUUAAUCGAGGAUCCCGUCCGCAUUGGAUAACACUAC-5' helix-form xAA.xxAxA.A.x...x.x..Axxxx.x..x.xAAA...xx..x 1 A.C2793 A.A2754 C-A -- -- c.W c.-W 2 A.U2795 A.A2753 U-A WC 20-XX cWW cW-W 3 A.G2796 A.C2752 G-C WC 19-XIX cWW cW-W 4 A.C2797 A.G2751 C-G WC 19-XIX cWW cW-W 5 A.A2798 A.U2750 A-U WC 20-XX cWW cW-W 6 A.U2799 A.A2748 U-A WC 20-XX cWW cW-W 7 A.A2801 A.U2747 A-U WC 20-XX cWW cW-W 8 A.A2802 A.U2746 A-U WC 20-XX cWW cW-W 9 A.A2803 A.U2744 A-U WC 20-XX cWW cW-W 10 A.A2804 A.U2743 A-U WC 20-XX cWW cW-W 11 A.A2805 A.U2742 A-U WC 20-XX cWW cW-W 12 A.U2806 A.A2741 U-A WC 20-XX cWW cW-W 13 A.U2807 A.A2740 U-A WC 20-XX cWW cW-W 14 A.A2922 A.U2737 A-U WC 20-XX cWW cW-W 15 A.G2923 A.C2736 G-C WC 19-XIX cWW cW-W 16 A.U2924 A.G2735 U-G Wobble 28-XXVIII cWW cW-W 17 A.U2925 A.A2734 U-A WC 20-XX cWW cW-W 18 A.C2928 A.G2733 C-G WC 19-XIX cWW cW-W 19 A.C2929 A.G2732 C-G WC 19-XIX cWW cW-W 20 A.U2930 A.A2730 U-A WC 20-XX cWW cW-W 21 A.A2931 A.U2729 A-U WC 20-XX cWW cW-W 22 A.G2932 A.C2728 G-C WC 19-XIX cWW cW-W 23 A.G2933 A.C2727 G-C WC 19-XIX cWW cW-W 24 A.A2937 A.C2988 A-C ~rHoogsteen 25-XXV tHW tM-W 25 A.A2938 A.G2724 A-G -- -- cWW cW-W 26 A.C2939 A.U2991 C-U -- -- cWW cW-W 27 A.A2940 A.C2986 A-C -- -- cWW cW-W 28 A.G2941 A.C2985 G-C WC 19-XIX cWW cW-W 29 A.C2942 A.G2983 C-G WC 19-XIX cWW cW-W 30 A.G2943 A.C2982 G-C WC 19-XIX cWW cW-W 31 A.C2944 A.A2981 C-A ~Wobble -- cWW cW-W 32 A.A2946 A.U2980 A-U WC 20-XX cWW cW-W 33 A.U2947 A.U2979 U-U -- 16-XVI cWW cW-W 34 A.C2948 A.G2976 C-G WC 19-XIX cWW cW-W 35 A.C2949 A.G2975 C-G WC 19-XIX cWW cW-W 36 A.U2950 A.A2974 U-A WC 20-XX cWW cW-W 37 A.A2951 A.U2973 A-U WC 20-XX cWW cW-W 38 A.U2952 A.A2972 U-A WC 20-XX cWW cW-W 39 A.U2953 A.A2971 U-A WC 20-XX cWW cW-W 40 A.C2954 A.C2970 C-C -- -- cWW cW-W 41 A.U2955 A.A2968 U-A WC 20-XX cWW cW-W 42 A.G2957 A.C2967 G-C WC 19-XIX cWW cW-W 43 A.A2958 A.U2966 A-U WC 20-XX cWW cW-W 44 A.G2959 A.A2965 G-A Sheared 11-XI tSH tm-M 45 A.G3016 A.C2962 G+C rWC 22-XXII tWW tW+W -------------------------------------------------------------------------- helix#42[1] bps=4 strand-1 5'-GGUC-3' bp-type |||| strand-2 3'-CCAG-5' helix-form AAx 1 A.G2810 A.C2822 G-C WC 19-XIX cWW cW-W 2 A.G2811 A.C2821 G-C WC 19-XIX cWW cW-W 3 A.U2812 A.A2820 U-A WC 20-XX cWW cW-W 4 A.C2839 A.G2819 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#43[1] bps=10 strand-1 5'-AACUCCGAGU-3' bp-type ..|||||||. strand-2 3'-ACGAGGCUCA-5' helix-form .xA.A.Axx 1 A.A2837 A.A2830 A+A -- 02-II tHH tM+M 2 A.A2838 A.C2829 A-C -- -- cWW cW-W 3 A.C2840 A.G2828 C-G WC 19-XIX cWW cW-W 4 A.U2841 A.A2827 U-A WC 20-XX cWW cW-W 5 A.C2842 A.G2826 C-G WC 19-XIX cWW cW-W 6 A.C2843 A.G2825 C-G WC 19-XIX cWW cW-W 7 A.G2844 A.C2824 G-C WC 19-XIX cWW cW-W 8 A.A2845 A.U2823 A-U WC 20-XX cWW cW-W 9 A.G2846 A.C2915 G-C WC 19-XIX cWW cW-W 10 A.U2895 A.A2913 U+A -- -- cWH cW+M -------------------------------------------------------------------------- helix#44[1] bps=4 strand-1 5'-UCUC-3' bp-type .||. strand-2 3'-UGAU-5' helix-form xAx 1 A.U2854 A.U2850 U-U -- -- cWW cW-W 2 A.C2889 A.G2849 C-G WC 19-XIX cWW cW-W 3 A.U2890 A.A2848 U-A WC 20-XX cWW cW-W 4 A.C2891 A.U2894 C-U -- -- tWH tW-M -------------------------------------------------------------------------- helix#45[2] bps=9 strand-1 5'-GCUAAGACU-3' bp-type ||...|||. strand-2 3'-CGAAACUGA-5' helix-form A....A.. 1 A.G2855 A.C2877 G-C WC 19-XIX cWW cW-W 2 A.C2856 A.G2876 C-G WC 19-XIX cWW cW-W 3 A.U2857 A.A2875 U-A -- -- cWW cW-W 4 A.A2858 A.A2874 A-A ~Sheared -- tSH tm-M 5 A.A2859 A.A2873 A-A ~Sheared -- tHS tM-m 6 A.G2860 A.C2872 G-C WC 19-XIX cWW cW-W 7 A.A2861 A.U2871 A-U WC 20-XX cWW cW-W 8 A.C2862 A.G2870 C-G WC 19-XIX cWW cW-W 9 A.U2863 A.A2869 U-A -- -- cWW cW-W -------------------------------------------------------------------------- helix#46[1] bps=8 strand-1 5'-GAUCCAAU-3' bp-type ....|||. strand-2 3'-GCAAGUUC-5' helix-form xxxxAA. 1 A.G2896 A.G2917 G+G -- 04-IV tSS tm+m 2 A.A2897 A.C2912 A-C ~rHoogsteen 25-XXV tHW tM-W 3 A.U2898 A.A2910 U+A -- -- tWW tW+W 4 A.C2899 A.A3301 C-A -- -- cWS cW-m 5 A.C2900 A.G2909 C-G WC 19-XIX cWW cW-W 6 A.A2901 A.U2908 A-U WC 20-XX cWW cW-W 7 A.A2902 A.U2907 A-U WC 20-XX cWW cW-W 8 A.U2903 A.C2906 U-C -- -- tSH tm-M -------------------------------------------------------------------------- helix#47[4] bps=20 strand-1 5'-UGGAUCAGGACCCCGAUGGU-3' bp-type ||||.||||||||.|||||| strand-2 3'-AUCUUGUCCUGGGAUUAUCG-5' helix-form x.Ax.x.AA.xAx...... 1 A.U2994 A.A3069 U-A WC 20-XX cWW cW-W 2 A.G2995 A.U3067 G-U Wobble 28-XXVIII cWW cW-W 3 A.G2996 A.C3066 G-C WC 19-XIX cWW cW-W 4 A.A2997 A.U3065 A-U WC 20-XX cWW cW-W 5 A.U2998 A.U3062 U-U -- 16-XVI cWW cW-W 6 A.C2999 A.G3061 C-G WC 19-XIX cWW cW-W 7 A.A3000 A.U3058 A-U WC 20-XX cWW cW-W 8 A.G3001 A.C3057 G-C WC 19-XIX cWW cW-W 9 A.G3002 A.C3056 G-C WC 19-XIX cWW cW-W 10 A.A3003 A.U3055 A-U WC 20-XX cWW cW-W 11 A.C3004 A.G3054 C-G WC 19-XIX cWW cW-W 12 A.C3007 A.G3032 C-G WC 19-XIX cWW cW-W 13 A.C3008 A.G3031 C-G WC 19-XIX cWW cW-W 14 A.C3009 A.A3028 C+A -- -- cHW cM+W 15 A.G3010 A.U3027 G-U Wobble 28-XXVIII cWW cW-W 16 A.A3011 A.U3026 A-U WC 20-XX cWW cW-W 17 A.U3012 A.A3025 U-A WC 20-XX cWW cW-W 18 A.G3013 A.U3024 G-U Wobble 28-XXVIII cWW cW-W 19 A.G3014 A.C3023 G-C WC 19-XIX cWW cW-W 20 A.U3015 A.G3022 U-G Wobble 28-XXVIII cWW cW-W -------------------------------------------------------------------------- helix#48[1] bps=8 strand-1 5'-CAACGAUU-3' bp-type .|||||.. strand-2 3'-UUUGCUAA-5' helix-form xAAAAx. 1 A.C3043 A.U2618 C-U ~rHoogsteen -- tWH tW-M 2 A.A3044 A.U3038 A-U WC 20-XX cWW cW-W 3 A.A3045 A.U3037 A-U WC 20-XX cWW cW-W 4 A.C3046 A.G3036 C-G WC 19-XIX cWW cW-W 5 A.G3047 A.C3035 G-C WC 19-XIX cWW cW-W 6 A.A3048 A.U3034 A-U WC 20-XX cWW cW-W 7 A.U3049 A.A3053 U-A rHoogsteen 24-XXIV tWH tW-M 8 A.U3050 A.A3052 U-A -- -- tSH tm-M -------------------------------------------------------------------------- helix#49[2] bps=11 strand-1 5'-CAAGACCGGAG-3' bp-type ...|||||||. strand-2 3'-CGGCUGGCCUA-5' helix-form xxx..AxAA. 1 A.C3073 A.C2502 C+C -- 14-XIV tWW tW+W 2 A.A3074 A.G3095 A-G Sheared 11-XI tHS tM-m 3 A.A2503 A.G3094 A-G -- -- cSS cm-m 4 A.G3075 A.C3093 G-C WC 19-XIX cWW cW-W 5 A.A3076 A.U3092 A-U WC 20-XX cWW cW-W 6 A.C3077 A.G3091 C-G WC 19-XIX cWW cW-W 7 A.C3078 A.G3090 C-G WC 19-XIX cWW cW-W 8 A.G3079 A.C3088 G-C WC 19-XIX cWW cW-W 9 A.G3080 A.C3087 G-C WC 19-XIX cWW cW-W 10 A.A3081 A.U3086 A-U WC 20-XX cWW cW-W 11 A.G3082 A.A3085 G-A Sheared 11-XI tSH tm-M -------------------------------------------------------------------------- helix#50[4] bps=21 strand-1 5'-GGAAAGAGAAAUAAGGCCUUC-3' bp-type |....|||.|||||||||||. strand-2 3'-CAUCCCUCCUUAUUCCGGAAA-5' helix-form ..x..AA..A.xAAAAx... 1 A.G3131 A.C3126 G-C WC 19-XIX cWW cW-W 2 A.G3132 A.A3125 G-A Sheared 11-XI tSH tm-M 3 A.A3133 A.U3124 A-U rHoogsteen 24-XXIV tHW tM-W 4 A.A3135 A.C3121 A-C -- -- tHW tM-W 5 A.A3136 A.C3120 A-C ~Wobble -- cWW cW-W 6 A.G3137 A.C3119 G-C WC 19-XIX cWW cW-W 7 A.A3138 A.U3118 A-U WC 20-XX cWW cW-W 8 A.G3139 A.C3117 G-C WC 19-XIX cWW cW-W 9 A.A3140 A.C3116 A-C ~Wobble -- cWW cW-W 10 A.A3141 A.U3115 A-U WC 20-XX cWW cW-W 11 A.A3142 A.U3114 A-U WC 20-XX cWW cW-W 12 A.U3143 A.A3113 U-A WC 20-XX cWW cW-W 13 A.A3144 A.U3167 A-U WC 20-XX cWW cW-W 14 A.A3145 A.U3166 A-U WC 20-XX cWW cW-W 15 A.G3146 A.C3165 G-C WC 19-XIX cWW cW-W 16 A.G3147 A.C3164 G-C WC 19-XIX cWW cW-W 17 A.C3148 A.G3163 C-G WC 19-XIX cWW cW-W 18 A.C3152 A.G3161 C-G WC 19-XIX cWW cW-W 19 A.U3153 A.A3160 U-A WC 20-XX cWW cW-W 20 A.U3154 A.A3159 U-A WC 20-XX cWW cW-W 21 A.C3155 A.A3158 C+A -- -- tSW tm+W -------------------------------------------------------------------------- helix#51[1] bps=9 strand-1 5'-GUAAAUGAU-3' bp-type .|||..... strand-2 3'-GAUUCAAUA-5' helix-form .A..xxx. 1 A.G3173 A.G3196 G-G -- -- tHW tM-W 2 A.U3174 A.A3195 U-A WC 20-XX cWW cW-W 3 A.A3175 A.U3194 A-U WC 20-XX cWW cW-W 4 A.A3176 A.U3193 A-U WC 20-XX cWW cW-W 5 A.A3177 A.C3192 A-C ~Wobble -- cWW cW-W 6 A.U3188 A.A3191 U+A -- -- cWH cW+M 7 A.G3179 A.A3190 G-A Sheared 11-XI tSH tm-M 8 A.A3180 A.U3186 A-U rHoogsteen 24-XXIV tHW tM-W 9 A.U3181 A.A3185 U-A -- -- tHW tM-W -------------------------------------------------------------------------- helix#52[1] bps=5 strand-1 5'-ACCCA-3' bp-type ||||. strand-2 3'-UGGGA-5' helix-form AAAx 1 A.A3213 A.U3227 A-U WC 20-XX cWW cW-W 2 A.C3214 A.G3226 C-G WC 19-XIX cWW cW-W 3 A.C3215 A.G3225 C-G WC 19-XIX cWW cW-W 4 A.C3216 A.G3224 C-G WC 19-XIX cWW cW-W 5 A.A3218 A.A3223 A-A -- -- cSW cm-W -------------------------------------------------------------------------- helix#53[2] bps=11 strand-1 5'-CAGAGUGUCAA-3' bp-type ||||||||||| strand-2 3'-GUCUCGCAGUU-5' helix-form x.AA..xAAA 1 B.C1601 B.G1669 C-G WC 19-XIX cWW cW-W 2 B.A1603 B.U1668 A-U WC 20-XX cWW cW-W 3 B.G1604 B.C1667 G-C WC 19-XIX cWW cW-W 4 B.A1605 B.U1666 A-U WC 20-XX cWW cW-W 5 B.G1606 B.C1665 G-C WC 19-XIX cWW cW-W 6 B.U1607 B.G1664 U-G Wobble 28-XXVIII cWW cW-W 7 B.G1608 B.C1663 G-C WC 19-XIX cWW cW-W 8 B.U1648 B.A1661 U-A WC 20-XX cWW cW-W 9 B.C1649 B.G1660 C-G WC 19-XIX cWW cW-W 10 B.A1650 B.U1659 A-U WC 20-XX cWW cW-W 11 B.A1651 B.U1658 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- helix#54[3] bps=13 strand-1 5'-CCUUAGGAGCUAA-3' bp-type ..||.||.|||.. strand-2 3'-UCAACCCACGAAU-5' helix-form x.A..A.xA.xx 1 B.C1635 B.U1632 C-U -- -- tHW tM-W 2 B.C1637 B.C1631 C-C -- -- cWW cW-W 3 B.U1638 B.A1630 U-A WC 20-XX cWW cW-W 4 B.U1639 B.A1629 U-A WC 20-XX cWW cW-W 5 B.A1640 B.C1628 A-C ~Wobble -- cWW cW-W 6 B.G1641 B.C1627 G-C WC 19-XIX cWW cW-W 7 B.G1642 B.C1626 G-C WC 19-XIX cWW cW-W 8 B.A1643 B.A1625 A-A -- -- cWW cW-W 9 B.G1611 B.C1624 G-C WC 19-XIX cWW cW-W 10 B.C1612 B.G1623 C-G WC 19-XIX cWW cW-W 11 B.U1613 B.A1622 U-A WC 20-XX cWW cW-W 12 B.A1615 B.A1621 A-A -- -- cWS cW-m 13 B.A1616 B.U1646 A+U rWC 21-XXI tWW tW+W **************************************************************************** List of 87 stems Note: a stem is defined as a helix consisting of only canonical WC/wobble pairs, with a continuous backbone. stem#number[#helix-number containing this stem] Other terms are defined as in the above Helix section. -------------------------------------------------------------------- stem#1[#1] bps=2 strand-1 5'-GC-3' bp-type || strand-2 3'-CG-5' helix-form . 1 A.G1671 A.C1817 G-C WC 19-XIX cWW cW-W 2 A.C1672 A.G1816 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#2[#2] bps=2 strand-1 5'-GC-3' bp-type || strand-2 3'-CG-5' helix-form A 1 A.G1681 A.C1771 G-C WC 19-XIX cWW cW-W 2 A.C1682 A.G1770 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#3[#2] bps=2 strand-1 5'-CC-3' bp-type || strand-2 3'-GG-5' helix-form A 1 A.C1683 A.G1768 C-G WC 19-XIX cWW cW-W 2 A.C1684 A.G1767 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#4[#4] bps=2 strand-1 5'-UA-3' bp-type || strand-2 3'-AU-5' helix-form A 1 A.U1745 A.A1753 U-A WC 20-XX cWW cW-W 2 A.A1746 A.U1752 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#5[#5] bps=2 strand-1 5'-CC-3' bp-type || strand-2 3'-GG-5' helix-form A 1 A.C1785 A.G1792 C-G WC 19-XIX cWW cW-W 2 A.C1786 A.G1791 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#6[#7] bps=3 strand-1 5'-AGG-3' bp-type ||| strand-2 3'-UCC-5' helix-form AA 1 A.A1829 A.U1841 A-U WC 20-XX cWW cW-W 2 A.G1830 A.C1840 G-C WC 19-XIX cWW cW-W 3 A.G1831 A.C1839 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#7[#23] bps=3 strand-1 5'-AUU-3' bp-type ||| strand-2 3'-UGA-5' helix-form .. 1 A.A1860 A.U2305 A-U WC 20-XX cWW cW-W 2 A.U1861 A.G2304 U-G Wobble 28-XXVIII cWW cW-W 3 A.U1862 A.A2303 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#8[#9] bps=2 strand-1 5'-GC-3' bp-type || strand-2 3'-CG-5' helix-form A 1 A.G1879 A.C1895 G-C WC 19-XIX cWW cW-W 2 A.C1880 A.G1894 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#9[#10] bps=2 strand-1 5'-GG-3' bp-type || strand-2 3'-CC-5' helix-form A 1 A.G1883 A.C1890 G-C WC 19-XIX cWW cW-W 2 A.G1884 A.C1889 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#10[#8] bps=2 strand-1 5'-CC-3' bp-type || strand-2 3'-GG-5' helix-form A 1 A.C1903 A.G2019 C-G WC 19-XIX cWW cW-W 2 A.C1904 A.G2018 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#11[#8] bps=4 strand-1 5'-CCAG-3' bp-type |||| strand-2 3'-GGUC-5' helix-form AAA 1 A.C1910 A.G2009 C-G WC 19-XIX cWW cW-W 2 A.C1911 A.G2008 C-G WC 19-XIX cWW cW-W 3 A.A1912 A.U2007 A-U WC 20-XX cWW cW-W 4 A.G1913 A.C2006 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#12[#11] bps=5 strand-1 5'-ACCUA-3' bp-type ||||| strand-2 3'-UGGAU-5' helix-form AAAA 1 A.A1921 A.U1983 A-U WC 20-XX cWW cW-W 2 A.C1922 A.G1982 C-G WC 19-XIX cWW cW-W 3 A.C1923 A.G1981 C-G WC 19-XIX cWW cW-W 4 A.U1924 A.A1980 U-A WC 20-XX cWW cW-W 5 A.A1925 A.U1979 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#13[#11] bps=3 strand-1 5'-GAA-3' bp-type ||| strand-2 3'-UUU-5' helix-form .A 1 A.G1927 A.U1977 G-U Wobble 28-XXVIII cWW cW-W 2 A.A1928 A.U1976 A-U WC 20-XX cWW cW-W 3 A.A1929 A.U1975 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#14[#12] bps=3 strand-1 5'-GCU-3' bp-type ||| strand-2 3'-CGA-5' helix-form AA 1 A.G1932 A.C1942 G-C WC 19-XIX cWW cW-W 2 A.C1933 A.G1941 C-G WC 19-XIX cWW cW-W 3 A.U1934 A.A1940 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#15[#12] bps=3 strand-1 5'-CCC-3' bp-type ||| strand-2 3'-GGG-5' helix-form AA 1 A.C1946 A.G1970 C-G WC 19-XIX cWW cW-W 2 A.C1947 A.G1969 C-G WC 19-XIX cWW cW-W 3 A.C1948 A.G1968 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#16[#12] bps=4 strand-1 5'-CUAU-3' bp-type |||| strand-2 3'-GAUA-5' helix-form AAA 1 A.C1951 A.G1966 C-G WC 19-XIX cWW cW-W 2 A.U1952 A.A1965 U-A WC 20-XX cWW cW-W 3 A.A1953 A.U1964 A-U WC 20-XX cWW cW-W 4 A.U1954 A.A1963 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#17[#8] bps=2 strand-1 5'-GG-3' bp-type || strand-2 3'-CC-5' helix-form A 1 A.G1987 A.C1997 G-C WC 19-XIX cWW cW-W 2 A.G1988 A.C1996 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#18[#22] bps=6 strand-1 5'-GUCCAA-3' bp-type |||||| strand-2 3'-CAGGUU-5' helix-form .AAAA 1 A.G2022 A.C2271 G-C WC 19-XIX cWW cW-W 2 A.U2023 A.A2270 U-A WC 20-XX cWW cW-W 3 A.C2024 A.G2269 C-G WC 19-XIX cWW cW-W 4 A.C2025 A.G2268 C-G WC 19-XIX cWW cW-W 5 A.A2026 A.U2267 A-U WC 20-XX cWW cW-W 6 A.A2027 A.U2266 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#19[#14] bps=2 strand-1 5'-AC-3' bp-type || strand-2 3'-UG-5' helix-form . 1 A.A2045 A.U2095 A-U WC 20-XX cWW cW-W 2 A.C2046 A.G2094 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#20[#14] bps=7 strand-1 5'-UUAAAUU-3' bp-type ||||||| strand-2 3'-AAUUUAA-5' helix-form AAAA.. 1 A.U2048 A.A2091 U-A WC 20-XX cWW cW-W 2 A.U2049 A.A2090 U-A WC 20-XX cWW cW-W 3 A.A2050 A.U2089 A-U WC 20-XX cWW cW-W 4 A.A2051 A.U2088 A-U WC 20-XX cWW cW-W 5 A.A2052 A.U2087 A-U WC 20-XX cWW cW-W 6 A.U2053 A.A2086 U-A WC 20-XX cWW cW-W 7 A.U2054 A.A2085 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#21[#15] bps=3 strand-1 5'-UGC-3' bp-type ||| strand-2 3'-AUG-5' helix-form .. 1 A.U2055 A.A2084 U-A WC 20-XX cWW cW-W 2 A.G2056 A.U2083 G-U Wobble 28-XXVIII cWW cW-W 3 A.C2057 A.G2082 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#22[#15] bps=2 strand-1 5'-GA-3' bp-type || strand-2 3'-CU-5' helix-form A 1 A.G2063 A.C2076 G-C WC 19-XIX cWW cW-W 2 A.A2064 A.U2075 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#23[#16] bps=10 strand-1 5'-GUCCAAAGAG-3' bp-type |||||||||| strand-2 3'-CAGGUUUCUC-5' helix-form .AAAAA.AA 1 A.G2098 A.C2123 G-C WC 19-XIX cWW cW-W 2 A.U2099 A.A2122 U-A WC 20-XX cWW cW-W 3 A.C2100 A.G2121 C-G WC 19-XIX cWW cW-W 4 A.C2101 A.G2120 C-G WC 19-XIX cWW cW-W 5 A.A2102 A.U2119 A-U WC 20-XX cWW cW-W 6 A.A2103 A.U2118 A-U WC 20-XX cWW cW-W 7 A.A2104 A.U2117 A-U WC 20-XX cWW cW-W 8 A.G2105 A.C2116 G-C WC 19-XIX cWW cW-W 9 A.A2106 A.U2115 A-U WC 20-XX cWW cW-W 10 A.G2107 A.C2114 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#24[#17] bps=3 strand-1 5'-AGG-3' bp-type ||| strand-2 3'-UCC-5' helix-form AA 1 A.A2127 A.U2138 A-U WC 20-XX cWW cW-W 2 A.G2128 A.C2137 G-C WC 19-XIX cWW cW-W 3 A.G2129 A.C2136 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#25[#18] bps=3 strand-1 5'-GAG-3' bp-type ||| strand-2 3'-CUC-5' helix-form AA 1 A.G2143 A.C2257 G-C WC 19-XIX cWW cW-W 2 A.A2144 A.U2256 A-U WC 20-XX cWW cW-W 3 A.G2145 A.C2255 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#26[#18] bps=3 strand-1 5'-GAG-3' bp-type ||| strand-2 3'-CUC-5' helix-form AA 1 A.G2147 A.C2254 G-C WC 19-XIX cWW cW-W 2 A.A2148 A.U2253 A-U WC 20-XX cWW cW-W 3 A.G2149 A.C2252 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#27[#21] bps=3 strand-1 5'-GGC-3' bp-type ||| strand-2 3'-CCG-5' helix-form .. 1 A.G2173 A.C2187 G-C WC 19-XIX cWW cW-W 2 A.G2174 A.C2186 G-C WC 19-XIX cWW cW-W 3 A.C2175 A.G2185 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#28[#19] bps=3 strand-1 5'-AGC-3' bp-type ||| strand-2 3'-UCG-5' helix-form .. 1 A.A2200 A.U2211 A-U WC 20-XX cWW cW-W 2 A.G2201 A.C2210 G-C WC 19-XIX cWW cW-W 3 A.C2202 A.G2209 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#29[#22] bps=5 strand-1 5'-UCUAU-3' bp-type ||||| strand-2 3'-AGAUA-5' helix-form ..A. 1 A.U2275 A.A2290 U-A WC 20-XX cWW cW-W 2 A.C2276 A.G2289 C-G WC 19-XIX cWW cW-W 3 A.U2277 A.A2288 U-A WC 20-XX cWW cW-W 4 A.A2278 A.U2287 A-U WC 20-XX cWW cW-W 5 A.U2279 A.A2286 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#30[#23] bps=2 strand-1 5'-AC-3' bp-type || strand-2 3'-UG-5' helix-form A 1 A.A2313 A.U2674 A-U WC 20-XX cWW cW-W 2 A.C2314 A.G2673 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#31[#24] bps=3 strand-1 5'-GAA-3' bp-type ||| strand-2 3'-CUU-5' helix-form AA 1 A.G2317 A.C2326 G-C WC 19-XIX cWW cW-W 2 A.A2318 A.U2325 A-U WC 20-XX cWW cW-W 3 A.A2319 A.U2324 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#32[#24] bps=3 strand-1 5'-UCC-3' bp-type ||| strand-2 3'-AGG-5' helix-form A. 1 A.U2327 A.A2450 U-A WC 20-XX cWW cW-W 2 A.C2328 A.G2449 C-G WC 19-XIX cWW cW-W 3 A.C2329 A.G2448 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#33[#25] bps=4 strand-1 5'-GCAU-3' bp-type |||| strand-2 3'-CGUA-5' helix-form AAA 1 A.G2333 A.C2441 G-C WC 19-XIX cWW cW-W 2 A.C2334 A.G2440 C-G WC 19-XIX cWW cW-W 3 A.A2335 A.U2439 A-U WC 20-XX cWW cW-W 4 A.U2336 A.A2438 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#34[#27] bps=5 strand-1 5'-GUCAG-3' bp-type ||||| strand-2 3'-CAGUC-5' helix-form AAA. 1 A.G2345 A.C2368 G-C WC 19-XIX cWW cW-W 2 A.U2346 A.A2367 U-A WC 20-XX cWW cW-W 3 A.C2347 A.G2366 C-G WC 19-XIX cWW cW-W 4 A.A2348 A.U2365 A-U WC 20-XX cWW cW-W 5 A.G2349 A.C2364 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#35[#28] bps=3 strand-1 5'-CAG-3' bp-type ||| strand-2 3'-GUC-5' helix-form A. 1 A.C2375 A.G2421 C-G WC 19-XIX cWW cW-W 2 A.A2376 A.U2420 A-U WC 20-XX cWW cW-W 3 A.G2377 A.C2419 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#36[#29] bps=4 strand-1 5'-AAUA-3' bp-type |||| strand-2 3'-UUAU-5' helix-form AAA 1 A.A2381 A.U2411 A-U WC 20-XX cWW cW-W 2 A.A2382 A.U2410 A-U WC 20-XX cWW cW-W 3 A.U2383 A.A2409 U-A WC 20-XX cWW cW-W 4 A.A2384 A.U2408 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#37[#31] bps=2 strand-1 5'-CC-3' bp-type || strand-2 3'-GG-5' helix-form . 1 A.C2427 A.G2436 C-G WC 19-XIX cWW cW-W 2 A.C2428 A.G2435 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#38[#23] bps=4 strand-1 5'-GGUU-3' bp-type |||| strand-2 3'-CCAA-5' helix-form AA. 1 A.G2453 A.C2671 G-C WC 19-XIX cWW cW-W 2 A.G2454 A.C2670 G-C WC 19-XIX cWW cW-W 3 A.U2455 A.A2669 U-A WC 20-XX cWW cW-W 4 A.U2456 A.A2668 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#39[#23] bps=5 strand-1 5'-AAAGU-3' bp-type ||||| strand-2 3'-UUUCA-5' helix-form AAAA 1 A.A2461 A.U2666 A-U WC 20-XX cWW cW-W 2 A.A2462 A.U2665 A-U WC 20-XX cWW cW-W 3 A.A2463 A.U2664 A-U WC 20-XX cWW cW-W 4 A.G2464 A.C2663 G-C WC 19-XIX cWW cW-W 5 A.U2465 A.A2662 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#40[#32] bps=2 strand-1 5'-AG-3' bp-type || strand-2 3'-UC-5' helix-form A 1 A.A2469 A.U2658 A-U WC 20-XX cWW cW-W 2 A.G2470 A.C2657 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#41[#32] bps=4 strand-1 5'-ACCC-3' bp-type |||| strand-2 3'-UGGG-5' helix-form AAA 1 A.A2487 A.U2648 A-U WC 20-XX cWW cW-W 2 A.C2488 A.G2647 C-G WC 19-XIX cWW cW-W 3 A.C2489 A.G2646 C-G WC 19-XIX cWW cW-W 4 A.C2490 A.G2645 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#42[#32] bps=2 strand-1 5'-CG-3' bp-type || strand-2 3'-GC-5' helix-form A 1 A.C2491 A.G2643 C-G WC 19-XIX cWW cW-W 2 A.G2492 A.C2642 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#43[#33] bps=2 strand-1 5'-GU-3' bp-type || strand-2 3'-CA-5' helix-form . 1 A.G2496 A.C2508 G-C WC 19-XIX cWW cW-W 2 A.U2497 A.A2507 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#44[#34] bps=6 strand-1 5'-CCUCUA-3' bp-type |||||| strand-2 3'-GGAGAU-5' helix-form AAAAA 1 A.C2513 A.G2537 C-G WC 19-XIX cWW cW-W 2 A.C2514 A.G2536 C-G WC 19-XIX cWW cW-W 3 A.U2515 A.A2535 U-A WC 20-XX cWW cW-W 4 A.C2516 A.G2534 C-G WC 19-XIX cWW cW-W 5 A.U2517 A.A2533 U-A WC 20-XX cWW cW-W 6 A.A2518 A.U2532 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#45[#35] bps=3 strand-1 5'-GCC-3' bp-type ||| strand-2 3'-CGG-5' helix-form A. 1 A.G2542 A.C2637 G-C WC 19-XIX cWW cW-W 2 A.C2543 A.G2636 C-G WC 19-XIX cWW cW-W 3 A.C2544 A.G2635 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#46[#36] bps=3 strand-1 5'-GCC-3' bp-type ||| strand-2 3'-CGG-5' helix-form .A 1 A.G2546 A.C2569 G-C WC 19-XIX cWW cW-W 2 A.C2547 A.G2568 C-G WC 19-XIX cWW cW-W 3 A.C2548 A.G2567 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#47[#36] bps=2 strand-1 5'-GU-3' bp-type || strand-2 3'-CA-5' helix-form . 1 A.G2551 A.C2566 G-C WC 19-XIX cWW cW-W 2 A.U2552 A.A2565 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#48[#36] bps=4 strand-1 5'-GACA-3' bp-type |||| strand-2 3'-UUGU-5' helix-form .A. 1 A.G2553 A.U2562 G-U Wobble 28-XXVIII cWW cW-W 2 A.A2554 A.U2561 A-U WC 20-XX cWW cW-W 3 A.C2555 A.G2560 C-G WC 19-XIX cWW cW-W 4 A.A2556 A.U2559 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#49[#37] bps=5 strand-1 5'-CGCGG-3' bp-type ||||| strand-2 3'-GUGCC-5' helix-form ..AA 1 A.C2570 A.G2587 C-G WC 19-XIX cWW cW-W 2 A.G2571 A.U2586 G-U Wobble 28-XXVIII cWW cW-W 3 A.C2572 A.G2585 C-G WC 19-XIX cWW cW-W 4 A.G2573 A.C2584 G-C WC 19-XIX cWW cW-W 5 A.G2574 A.C2583 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#50[#36] bps=5 strand-1 5'-GUUCC-3' bp-type ||||| strand-2 3'-CAGGG-5' helix-form A..A 1 A.G2608 A.C2624 G-C WC 19-XIX cWW cW-W 2 A.U2609 A.A2623 U-A WC 20-XX cWW cW-W 3 A.U2610 A.G2622 U-G Wobble 28-XXVIII cWW cW-W 4 A.C2611 A.G2621 C-G WC 19-XIX cWW cW-W 5 A.C2612 A.G2620 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#51[#6] bps=5 strand-1 5'-GCCCG-3' bp-type ||||| strand-2 3'-CGGGC-5' helix-form AAAA 1 A.G2686 A.C2703 G-C WC 19-XIX cWW cW-W 2 A.C2687 A.G2702 C-G WC 19-XIX cWW cW-W 3 A.C2688 A.G2701 C-G WC 19-XIX cWW cW-W 4 A.C2689 A.G2700 C-G WC 19-XIX cWW cW-W 5 A.G2690 A.C2699 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#52[#39] bps=2 strand-1 5'-AG-3' bp-type || strand-2 3'-UC-5' helix-form . 1 A.A2711 A.U3107 A-U WC 20-XX cWW cW-W 2 A.G2712 A.C3106 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#53[#39] bps=3 strand-1 5'-AGA-3' bp-type ||| strand-2 3'-UCU-5' helix-form AA 1 A.A2715 A.U3104 A-U WC 20-XX cWW cW-W 2 A.G2716 A.C3103 G-C WC 19-XIX cWW cW-W 3 A.A2717 A.U3102 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#54[#40] bps=2 strand-1 5'-GA-3' bp-type || strand-2 3'-CU-5' helix-form A 1 A.G2719 A.C3099 G-C WC 19-XIX cWW cW-W 2 A.A2720 A.U3098 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#55[#41] bps=4 strand-1 5'-CCUA-3' bp-type |||| strand-2 3'-GGAU-5' helix-form A.. 1 A.C2727 A.G2933 C-G WC 19-XIX cWW cW-W 2 A.C2728 A.G2932 C-G WC 19-XIX cWW cW-W 3 A.U2729 A.A2931 U-A WC 20-XX cWW cW-W 4 A.A2730 A.U2930 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#56[#41] bps=2 strand-1 5'-GG-3' bp-type || strand-2 3'-CC-5' helix-form . 1 A.G2732 A.C2929 G-C WC 19-XIX cWW cW-W 2 A.G2733 A.C2928 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#57[#41] bps=4 strand-1 5'-AGCU-3' bp-type |||| strand-2 3'-UUGA-5' helix-form ... 1 A.A2734 A.U2925 A-U WC 20-XX cWW cW-W 2 A.G2735 A.U2924 G-U Wobble 28-XXVIII cWW cW-W 3 A.C2736 A.G2923 C-G WC 19-XIX cWW cW-W 4 A.U2737 A.A2922 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#58[#41] bps=5 strand-1 5'-AAUUU-3' bp-type ||||| strand-2 3'-UUAAA-5' helix-form .A.A 1 A.A2740 A.U2807 A-U WC 20-XX cWW cW-W 2 A.A2741 A.U2806 A-U WC 20-XX cWW cW-W 3 A.U2742 A.A2805 U-A WC 20-XX cWW cW-W 4 A.U2743 A.A2804 U-A WC 20-XX cWW cW-W 5 A.U2744 A.A2803 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#59[#41] bps=2 strand-1 5'-UU-3' bp-type || strand-2 3'-AA-5' helix-form A 1 A.U2746 A.A2802 U-A WC 20-XX cWW cW-W 2 A.U2747 A.A2801 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#60[#41] bps=4 strand-1 5'-UGCA-3' bp-type |||| strand-2 3'-ACGU-5' helix-form .AA 1 A.U2750 A.A2798 U-A WC 20-XX cWW cW-W 2 A.G2751 A.C2797 G-C WC 19-XIX cWW cW-W 3 A.C2752 A.G2796 C-G WC 19-XIX cWW cW-W 4 A.A2753 A.U2795 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#61[#42] bps=3 strand-1 5'-GGU-3' bp-type ||| strand-2 3'-CCA-5' helix-form AA 1 A.G2810 A.C2822 G-C WC 19-XIX cWW cW-W 2 A.G2811 A.C2821 G-C WC 19-XIX cWW cW-W 3 A.U2812 A.A2820 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#62[#43] bps=6 strand-1 5'-UCGGAG-3' bp-type |||||| strand-2 3'-AGCCUC-5' helix-form A.A.A 1 A.U2823 A.A2845 U-A WC 20-XX cWW cW-W 2 A.C2824 A.G2844 C-G WC 19-XIX cWW cW-W 3 A.G2825 A.C2843 G-C WC 19-XIX cWW cW-W 4 A.G2826 A.C2842 G-C WC 19-XIX cWW cW-W 5 A.A2827 A.U2841 A-U WC 20-XX cWW cW-W 6 A.G2828 A.C2840 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#63[#44] bps=2 strand-1 5'-AG-3' bp-type || strand-2 3'-UC-5' helix-form A 1 A.A2848 A.U2890 A-U WC 20-XX cWW cW-W 2 A.G2849 A.C2889 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#64[#45] bps=2 strand-1 5'-GC-3' bp-type || strand-2 3'-CG-5' helix-form A 1 A.G2855 A.C2877 G-C WC 19-XIX cWW cW-W 2 A.C2856 A.G2876 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#65[#45] bps=3 strand-1 5'-GAC-3' bp-type ||| strand-2 3'-CUG-5' helix-form A. 1 A.G2860 A.C2872 G-C WC 19-XIX cWW cW-W 2 A.A2861 A.U2871 A-U WC 20-XX cWW cW-W 3 A.C2862 A.G2870 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#66[#46] bps=3 strand-1 5'-CAA-3' bp-type ||| strand-2 3'-GUU-5' helix-form AA 1 A.C2900 A.G2909 C-G WC 19-XIX cWW cW-W 2 A.A2901 A.U2908 A-U WC 20-XX cWW cW-W 3 A.A2902 A.U2907 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#67[#41] bps=2 strand-1 5'-CG-3' bp-type || strand-2 3'-GC-5' helix-form . 1 A.C2942 A.G2983 C-G WC 19-XIX cWW cW-W 2 A.G2943 A.C2982 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#68[#41] bps=6 strand-1 5'-CCUAUU-3' bp-type |||||| strand-2 3'-GGAUAA-5' helix-form AAA.. 1 A.C2948 A.G2976 C-G WC 19-XIX cWW cW-W 2 A.C2949 A.G2975 C-G WC 19-XIX cWW cW-W 3 A.U2950 A.A2974 U-A WC 20-XX cWW cW-W 4 A.A2951 A.U2973 A-U WC 20-XX cWW cW-W 5 A.U2952 A.A2972 U-A WC 20-XX cWW cW-W 6 A.U2953 A.A2971 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#69[#41] bps=2 strand-1 5'-GA-3' bp-type || strand-2 3'-CU-5' helix-form . 1 A.G2957 A.C2967 G-C WC 19-XIX cWW cW-W 2 A.A2958 A.U2966 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#70[#47] bps=3 strand-1 5'-GGA-3' bp-type ||| strand-2 3'-UCU-5' helix-form .A 1 A.G2995 A.U3067 G-U Wobble 28-XXVIII cWW cW-W 2 A.G2996 A.C3066 G-C WC 19-XIX cWW cW-W 3 A.A2997 A.U3065 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#71[#47] bps=5 strand-1 5'-AGGAC-3' bp-type ||||| strand-2 3'-UCCUG-5' helix-form .AA. 1 A.A3000 A.U3058 A-U WC 20-XX cWW cW-W 2 A.G3001 A.C3057 G-C WC 19-XIX cWW cW-W 3 A.G3002 A.C3056 G-C WC 19-XIX cWW cW-W 4 A.A3003 A.U3055 A-U WC 20-XX cWW cW-W 5 A.C3004 A.G3054 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#72[#47] bps=2 strand-1 5'-CC-3' bp-type || strand-2 3'-GG-5' helix-form A 1 A.C3007 A.G3032 C-G WC 19-XIX cWW cW-W 2 A.C3008 A.G3031 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#73[#47] bps=6 strand-1 5'-GAUGGU-3' bp-type |||||| strand-2 3'-UUAUCG-5' helix-form ..... 1 A.G3010 A.U3027 G-U Wobble 28-XXVIII cWW cW-W 2 A.A3011 A.U3026 A-U WC 20-XX cWW cW-W 3 A.U3012 A.A3025 U-A WC 20-XX cWW cW-W 4 A.G3013 A.U3024 G-U Wobble 28-XXVIII cWW cW-W 5 A.G3014 A.C3023 G-C WC 19-XIX cWW cW-W 6 A.U3015 A.G3022 U-G Wobble 28-XXVIII cWW cW-W -------------------------------------------------------------------------- stem#74[#48] bps=5 strand-1 5'-UCGUU-3' bp-type ||||| strand-2 3'-AGCAA-5' helix-form AAAA 1 A.U3034 A.A3048 U-A WC 20-XX cWW cW-W 2 A.C3035 A.G3047 C-G WC 19-XIX cWW cW-W 3 A.G3036 A.C3046 G-C WC 19-XIX cWW cW-W 4 A.U3037 A.A3045 U-A WC 20-XX cWW cW-W 5 A.U3038 A.A3044 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#75[#49] bps=4 strand-1 5'-GACC-3' bp-type |||| strand-2 3'-CUGG-5' helix-form ..A 1 A.G3075 A.C3093 G-C WC 19-XIX cWW cW-W 2 A.A3076 A.U3092 A-U WC 20-XX cWW cW-W 3 A.C3077 A.G3091 C-G WC 19-XIX cWW cW-W 4 A.C3078 A.G3090 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#76[#49] bps=3 strand-1 5'-GGA-3' bp-type ||| strand-2 3'-CCU-5' helix-form AA 1 A.G3079 A.C3088 G-C WC 19-XIX cWW cW-W 2 A.G3080 A.C3087 G-C WC 19-XIX cWW cW-W 3 A.A3081 A.U3086 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#77[#50] bps=3 strand-1 5'-AUU-3' bp-type ||| strand-2 3'-UAA-5' helix-form .A 1 A.A3113 A.U3143 A-U WC 20-XX cWW cW-W 2 A.U3114 A.A3142 U-A WC 20-XX cWW cW-W 3 A.U3115 A.A3141 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#78[#50] bps=3 strand-1 5'-CUC-3' bp-type ||| strand-2 3'-GAG-5' helix-form AA 1 A.C3117 A.G3139 C-G WC 19-XIX cWW cW-W 2 A.U3118 A.A3138 U-A WC 20-XX cWW cW-W 3 A.C3119 A.G3137 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#79[#50] bps=5 strand-1 5'-AAGGC-3' bp-type ||||| strand-2 3'-UUCCG-5' helix-form AAAA 1 A.A3144 A.U3167 A-U WC 20-XX cWW cW-W 2 A.A3145 A.U3166 A-U WC 20-XX cWW cW-W 3 A.G3146 A.C3165 G-C WC 19-XIX cWW cW-W 4 A.G3147 A.C3164 G-C WC 19-XIX cWW cW-W 5 A.C3148 A.G3163 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#80[#50] bps=3 strand-1 5'-CUU-3' bp-type ||| strand-2 3'-GAA-5' helix-form .. 1 A.C3152 A.G3161 C-G WC 19-XIX cWW cW-W 2 A.U3153 A.A3160 U-A WC 20-XX cWW cW-W 3 A.U3154 A.A3159 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#81[#51] bps=3 strand-1 5'-UAA-3' bp-type ||| strand-2 3'-AUU-5' helix-form A. 1 A.U3174 A.A3195 U-A WC 20-XX cWW cW-W 2 A.A3175 A.U3194 A-U WC 20-XX cWW cW-W 3 A.A3176 A.U3193 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#82[#52] bps=4 strand-1 5'-ACCC-3' bp-type |||| strand-2 3'-UGGG-5' helix-form AAA 1 A.A3213 A.U3227 A-U WC 20-XX cWW cW-W 2 A.C3214 A.G3226 C-G WC 19-XIX cWW cW-W 3 A.C3215 A.G3225 C-G WC 19-XIX cWW cW-W 4 A.C3216 A.G3224 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#83[#53] bps=6 strand-1 5'-AGAGUG-3' bp-type |||||| strand-2 3'-UCUCGC-5' helix-form .AA.. 1 B.A1603 B.U1668 A-U WC 20-XX cWW cW-W 2 B.G1604 B.C1667 G-C WC 19-XIX cWW cW-W 3 B.A1605 B.U1666 A-U WC 20-XX cWW cW-W 4 B.G1606 B.C1665 G-C WC 19-XIX cWW cW-W 5 B.U1607 B.G1664 U-G Wobble 28-XXVIII cWW cW-W 6 B.G1608 B.C1663 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#84[#54] bps=3 strand-1 5'-GCU-3' bp-type ||| strand-2 3'-CGA-5' helix-form A. 1 B.G1611 B.C1624 G-C WC 19-XIX cWW cW-W 2 B.C1612 B.G1623 C-G WC 19-XIX cWW cW-W 3 B.U1613 B.A1622 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#85[#54] bps=2 strand-1 5'-CC-3' bp-type || strand-2 3'-GG-5' helix-form A 1 B.C1626 B.G1642 C-G WC 19-XIX cWW cW-W 2 B.C1627 B.G1641 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#86[#54] bps=2 strand-1 5'-AA-3' bp-type || strand-2 3'-UU-5' helix-form A 1 B.A1629 B.U1639 A-U WC 20-XX cWW cW-W 2 B.A1630 B.U1638 A-U WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#87[#53] bps=4 strand-1 5'-UCAA-3' bp-type |||| strand-2 3'-AGUU-5' helix-form AAA 1 B.U1648 B.A1661 U-A WC 20-XX cWW cW-W 2 B.C1649 B.G1660 C-G WC 19-XIX cWW cW-W 3 B.A1650 B.U1659 A-U WC 20-XX cWW cW-W 4 B.A1651 B.U1658 A-U WC 20-XX cWW cW-W **************************************************************************** List of 47 isolated WC/wobble pairs Note: isolated WC/wobble pairs are assigned negative indices to differentiate them from the stem numbers, which are positive. -------------------------------------------------------------------- [#2] -1 A.C1678 A.G1797 C-G WC 19-XIX cWW cW-W [#3] -2 A.A1722 A.U1729 A-U WC 20-XX cWW cW-W -- -3 A.C1726 A.G1748 C-G WC 19-XIX cWW cW-W [#4] -4 A.A1739 A.U1758 A-U WC 20-XX cWW cW-W -- -5 A.A1803 A.U1807 A-U WC 20-XX cWW cW-W [#38] -6 A.C1827 A.G2681 C-G WC 19-XIX cWW cW-W -- -7 A.U1843 A.A2696 U-A WC 20-XX cWW cW-W [#38] -8 A.C1845 A.G1858 C-G WC 19-XIX cWW cW-W [#38] -9 A.U1847 A.A1856 U-A WC 20-XX cWW cW-W [#23] -10 A.A1863 A.U2301 A-U WC 20-XX cWW cW-W [#23] -11 A.C1865 A.G2300 C-G WC 19-XIX cWW cW-W [#9] -12 A.C1875 A.G1899 C-G WC 19-XIX cWW cW-W [#9] -13 A.U1876 A.A1897 U-A WC 20-XX cWW cW-W [#8] -14 A.G1906 A.C2016 G-C WC 19-XIX cWW cW-W [#8] -15 A.C1915 A.G2004 C-G WC 19-XIX cWW cW-W [#11] -16 A.C1930 A.G1973 C-G WC 19-XIX cWW cW-W [#33] -17 A.G1939 A.C2494 G-C WC 19-XIX cWW cW-W -- -18 A.A1962 A.U3096 A-U WC 20-XX cWW cW-W [#8] -19 A.G1985 A.C2001 G-C WC 19-XIX cWW cW-W [#14] -20 A.G2032 A.C2043 G-C WC 19-XIX cWW cW-W [#13] -21 A.A2033 A.U2041 A-U WC 20-XX cWW cW-W [#13] -22 A.U2035 A.G2040 U-G Wobble 28-XXVIII cWW cW-W -- -23 A.C2125 A.G2140 C-G WC 19-XIX cWW cW-W [#18] -24 A.A2153 A.U2248 A-U WC 20-XX cWW cW-W [#20] -25 A.U2168 A.A2192 U-A WC 20-XX cWW cW-W [#20] -26 A.G2170 A.C2190 G-C WC 19-XIX cWW cW-W [#19] -27 A.G2197 A.C2212 G-C WC 19-XIX cWW cW-W [#23] -28 A.A2306 A.U2680 A-U WC 20-XX cWW cW-W [#26] -29 A.G2343 A.C2423 G-C WC 19-XIX cWW cW-W [#30] -30 A.C2400 A.G2403 C-G WC 19-XIX cWW cW-W [#23] -31 A.A2466 A.U2660 A-U WC 20-XX cWW cW-W [#32] -32 A.A2473 A.U2656 A-U WC 20-XX cWW cW-W [#32] -33 A.G2478 A.C2653 G-C WC 19-XIX cWW cW-W [#36] -34 A.G2596 A.U2630 G-U Wobble 28-XXVIII cWW cW-W [#36] -35 A.C2597 A.G2627 C-G WC 19-XIX cWW cW-W [#38] -36 A.C2683 A.G2697 C-G WC 19-XIX cWW cW-W [#41] -37 A.A2748 A.U2799 A-U WC 20-XX cWW cW-W [#42] -38 A.G2819 A.C2839 G-C WC 19-XIX cWW cW-W [#43] -39 A.G2846 A.C2915 G-C WC 19-XIX cWW cW-W -- -40 A.C2867 A.G2916 C-G WC 19-XIX cWW cW-W [#41] -41 A.G2941 A.C2985 G-C WC 19-XIX cWW cW-W [#41] -42 A.A2946 A.U2980 A-U WC 20-XX cWW cW-W [#41] -43 A.U2955 A.A2968 U-A WC 20-XX cWW cW-W [#47] -44 A.U2994 A.A3069 U-A WC 20-XX cWW cW-W [#47] -45 A.C2999 A.G3061 C-G WC 19-XIX cWW cW-W [#50] -46 A.C3126 A.G3131 C-G WC 19-XIX cWW cW-W [#53] -47 B.C1601 B.G1669 C-G WC 19-XIX cWW cW-W **************************************************************************** List of 20 coaxial stacks 1 Helix#2 contains 2 stems: [#2,#3] 2 Helix#8 contains 3 stems: [#10,#11,#17] 3 Helix#11 contains 2 stems: [#12,#13] 4 Helix#12 contains 3 stems: [#14,#15,#16] 5 Helix#14 contains 2 stems: [#19,#20] 6 Helix#15 contains 2 stems: [#21,#22] 7 Helix#18 contains 2 stems: [#25,#26] 8 Helix#22 contains 2 stems: [#18,#29] 9 Helix#23 contains 4 stems: [#7,#30,#38,#39] 10 Helix#24 contains 2 stems: [#31,#32] 11 Helix#32 contains 3 stems: [#40,#41,#42] 12 Helix#36 contains 4 stems: [#48,#47,#46,#50] 13 Helix#39 contains 2 stems: [#52,#53] 14 Helix#41 contains 9 stems: [#60,#59,#58,#57,#56,#55,#67,#68,#69] 15 Helix#45 contains 2 stems: [#64,#65] 16 Helix#47 contains 4 stems: [#70,#71,#72,#73] 17 Helix#49 contains 2 stems: [#75,#76] 18 Helix#50 contains 4 stems: [#78,#77,#79,#80] 19 Helix#53 contains 2 stems: [#83,#87] 20 Helix#54 contains 3 stems: [#86,#85,#84] **************************************************************************** List of 350 base stacks Note: a stack is an ordered list of nucleotides assembled together via base-stacking interactions, regardless of backbone connectivity. Stacking interactions within a stem are *not* included. 1 nts=2 CU A.C1678,A.U1679 2 nts=2 CG A.C1683,A.G1770 3 nts=2 CW A.C1693,Y.TRP178 4 nts=2 UF A.U1701,9.PHE30 5 nts=2 AC A.A1705,A.C1706 6 nts=2 CF A.C1707,5.PHE87 7 nts=2 AF A.A1712,5.PHE66 8 nts=2 AC A.A1713,A.C1714 9 nts=2 AG A.A1724,A.G2015 10 nts=2 UU A.U1728,A.U1729 11 nts=2 AY A.A1731,i.TYR118 12 nts=2 CR A.C1769,F.ARG108 13 nts=2 CA A.C1771,A.A1772 14 nts=2 AG A.A1775,A.G1776 15 nts=2 AU A.A1781,A.U1783 16 nts=2 UA A.U1807,A.A1808 17 nts=2 UH A.U1824,a.HIS121 18 nts=2 AG A.A1825,A.G1826 19 nts=2 UA A.U1834,A.A1835 20 nts=2 UA A.U1841,A.A1842 21 nts=2 AA A.A1867,A.A2298 22 nts=2 GC A.G1868,A.C1903 23 nts=2 AH A.A1869,i.HIS120 24 nts=2 AC A.A1870,A.C1902 25 nts=2 UU A.U1876,A.U1877 26 nts=2 GU A.G1879,A.U1896 27 nts=2 AA A.A1882,A.A1893 28 nts=2 GA A.G1883,A.A1891 29 nts=2 GA A.G1884,A.A1885 30 nts=2 GH A.G1886,i.HIS69 31 nts=2 AD A.A1892,3.ASP182 32 nts=2 AA A.A1925,A.A1926 33 nts=2 UA A.U1934,A.A1935 34 nts=2 AA A.A1938,A.A1940 35 nts=2 CG A.C1948,A.G1949 36 nts=2 UC A.U1950,A.C1951 37 nts=2 CA A.C1959,A.A2434 38 nts=2 AA A.A1961,A.A1999 39 nts=2 AC A.A1962,A.C2501 40 nts=2 GU A.G1966,A.U1967 41 nts=2 GU A.G1973,A.U1975 42 nts=2 AA A.A1974,A.A1991 43 nts=2 GC A.G1988,A.C1989 44 nts=2 GC A.G1990,A.C1992 45 nts=2 CC A.C1997,A.C2001 46 nts=2 GU A.G2009,A.U2010 47 nts=2 GY A.G2011,i.TYR116 48 nts=2 CR A.C2016,M.ARG59 49 nts=2 GU A.G2019,A.U2020 50 nts=2 CU A.C2046,A.U2047 51 nts=2 UF A.U2055,o.PHE71 52 nts=2 AY A.A2064,f.TYR48 53 nts=2 AC A.A2091,A.C2092 54 nts=2 UG A.U2093,A.G2094 55 nts=2 UU A.U2095,A.U2096 56 nts=2 AA A.A2097,A.A2935 57 nts=2 GG A.G2107,A.G2108 58 nts=2 AR A.A2110,I.ARG35 59 nts=2 AA A.A2134,A.A2135 60 nts=2 UU A.U2138,A.U2139 61 nts=2 GR A.G2140,Z.ARG76 62 nts=2 GC A.G2147,A.C2255 63 nts=2 GU A.G2149,A.U2150 64 nts=2 GU A.G2170,A.U2171 65 nts=2 AA A.A2172,A.A2181 66 nts=2 AC A.A2200,A.C2212 67 nts=2 AA A.A2228,A.A2229 68 nts=2 CH A.C2234,K.HIS80 69 nts=2 CC A.C2235,A.C2236 70 nts=2 AW A.A2241,r.TRP192 71 nts=2 UG A.U2248,A.G2249 72 nts=2 AY A.A2251,R.TYR58 73 nts=2 CR A.C2262,S.ARG173 74 nts=2 UA A.U2296,A.A2297 75 nts=2 CA A.C2314,A.A2315 76 nts=2 GU A.G2317,A.U2327 77 nts=2 CU A.C2329,A.U2330 78 nts=2 UC A.U2342,A.C2423 79 nts=2 UY A.U2372,U.TYR96 80 nts=2 GC A.G2377,A.C2378 81 nts=2 AU A.A2384,A.U2385 82 nts=2 AW A.A2401,D.TRP265 83 nts=2 GU A.G2421,A.U2422 84 nts=2 GC A.G2436,A.C2437 85 nts=2 AW A.A2446,s.TRP66 86 nts=2 CU A.C2474,A.U2475 87 nts=2 CG A.C2476,A.G2477 88 nts=2 AU A.A2487,A.U2649 89 nts=2 CC A.C2490,A.C2491 90 nts=2 UA A.U2498,A.A2504 91 nts=2 AA A.A2505,A.A2507 92 nts=2 AA A.A2506,A.A2601 93 nts=2 CH A.C2523,D.HIS87 94 nts=2 UN A.U2531,D.ASN253 95 nts=2 UG A.U2545,A.G2635 96 nts=2 GU A.G2546,A.U2594 97 nts=2 GA A.G2553,A.A2565 98 nts=2 AA A.A2564,A.A2633 99 nts=2 CG A.C2566,A.G2567 100 nts=2 AC A.A2582,A.C2583 101 nts=2 GC A.G2587,A.C2588 102 nts=2 UG A.U2599,A.G2608 103 nts=2 AU A.A2600,A.U2602 104 nts=2 AA A.A2615,A.A2616 105 nts=2 GG A.G2643,A.G2645 106 nts=2 UC A.U2658,A.C2659 107 nts=2 GA A.G2695,A.A3059 108 nts=2 AC A.A2696,A.C2699 109 nts=2 AC A.A2709,A.C2710 110 nts=2 AG A.A2723,A.G2989 111 nts=2 AG A.A2730,A.G2732 112 nts=2 GA A.G2733,A.A2734 113 nts=2 UU A.U2737,A.U2738 114 nts=2 AA A.A2740,A.A2922 115 nts=2 UQ A.U2795,X.GLN108 116 nts=2 AA A.A2802,A.A2803 117 nts=2 GA A.G2810,A.A2914 118 nts=2 UU A.U2812,A.U2813 119 nts=2 UC A.U2823,A.C2915 120 nts=2 AY A.A2853,1.TYR46 121 nts=2 CU A.C2862,A.U2863 122 nts=2 UC A.U2890,A.C2891 123 nts=2 AU A.A2902,A.U2903 124 nts=2 GQ A.G2916,M.GLN71 125 nts=2 CA A.C2967,A.A2968 126 nts=2 UU A.U2979,A.U2980 127 nts=2 GA A.G2983,A.A2984 128 nts=2 GG A.G2992,A.G3063 129 nts=2 CG A.C3007,A.G3054 130 nts=2 CC A.C3008,A.C3009 131 nts=2 UC A.U3015,A.C3017 132 nts=2 AG A.A3030,A.G3031 133 nts=2 GU A.G3032,A.U3033 134 nts=2 UA A.U3034,A.A3053 135 nts=2 UU A.U3038,A.U3039 136 nts=2 GU A.G3040,A.U3041 137 nts=2 AA A.A3051,A.A3052 138 nts=2 GG A.G3079,A.G3090 139 nts=2 AG A.A3081,A.G3082 140 nts=2 AA A.A3113,A.A3144 141 nts=2 CC A.C3116,A.C3117 142 nts=2 GG A.G3131,A.G3132 143 nts=2 UC A.U3154,A.C3155 144 nts=2 AA A.A3158,A.A3159 145 nts=2 GG A.G3161,A.G3163 146 nts=2 CY A.C3168,E.TYR269 147 nts=2 GU A.G3173,A.U3174 148 nts=2 UY A.U3183,K.TYR176 149 nts=2 CR A.C3187,4.ARG84 150 nts=2 CW A.C3189,r.TRP154 151 nts=2 UR A.U3227,E.ARG156 152 nts=2 GU B.G1608,B.U1648 153 nts=2 CA B.C1628,B.A1629 154 nts=2 AC B.A1661,B.C1663 155 nts=3 CAW A.C1703,A.A1702,2.TRP66 156 nts=3 UUR A.U1704,A.U1700,Y.ARG193 157 nts=3 GGA A.G1742,A.G1754,A.A1753 158 nts=3 AGC A.A1746,A.G1747,A.C1749 159 nts=3 GGA A.G1748,A.G1750,A.A1751 160 nts=3 AAC A.A1810,A.A1811,A.C1812 161 nts=3 AAG A.A1814,A.A1815,A.G1816 162 nts=3 AUA A.A1821,A.U1822,A.A1823 163 nts=3 CGG A.C1827,A.G2698,A.G2697 164 nts=3 ACR A.A1828,A.C2684,R.ARG32 165 nts=3 GAC A.G1831,A.A1832,A.C1833 166 nts=3 UAU A.U1843,A.A1853,A.U1854 167 nts=3 GAY A.G1894,A.A1881,g.TYR97 168 nts=3 GAU A.G1927,A.A1978,A.U1979 169 nts=3 ACA A.A1929,A.C1930,A.A1972 170 nts=3 GUG A.G1939,A.U2495,A.G2496 171 nts=3 UGU A.U1954,A.G1955,A.U1956 172 nts=3 GAA A.G1958,A.A1960,A.A1963 173 nts=3 AAC A.A1993,A.A1995,A.C1996 174 nts=3 GUU A.G2040,A.U2041,A.U2042 175 nts=3 AAG A.A2073,A.A2072,A.G2831 176 nts=3 UAA A.U2075,A.A2074,A.A2832 177 nts=3 GAC A.G2113,A.A2694,A.C2985 178 nts=3 GAA A.G2129,A.A2130,A.A2133 179 nts=3 AAR A.A2132,A.A2131,r.ARG168 180 nts=3 GAC A.G2143,A.A2258,A.C2259 181 nts=3 AAU A.A2169,A.A2192,A.U2193 182 nts=3 GAC A.G2173,A.A2188,A.C2189 183 nts=3 CCU A.C2175,A.C2176,A.U2177 184 nts=3 ACA A.A2191,A.C2190,A.A2198 185 nts=3 CGU A.C2202,A.G2203,A.U2204 186 nts=3 ACR A.A2260,A.C2261,S.ARG184 187 nts=3 GUU A.G2300,A.U2301,A.U2302 188 nts=3 GGU A.G2310,A.G2675,A.U2674 189 nts=3 AAC A.A2319,A.A2320,A.C2322 190 nts=3 AAU A.A2321,A.A2323,A.U2324 191 nts=3 GAC A.G2343,A.A2424,A.C2426 192 nts=3 GAA A.G2345,A.A2369,A.A2370 193 nts=3 GAU A.G2349,A.A2350,A.U2351 194 nts=3 CAC A.C2357,A.A2358,A.C2359 195 nts=3 CAF A.C2375,A.A2373,s.PHE274 196 nts=3 CCW A.C2380,A.C2379,9.TRP48 197 nts=3 ACQ A.A2388,A.C2389,5.GLN305 198 nts=3 CAF A.C2419,A.A2418,9.PHE50 199 nts=3 CUC A.C2441,A.U2442,A.C2443 200 nts=3 GAG A.G2453,A.A2672,A.G2673 201 nts=3 UAR A.U2456,A.A2457,O.ARG17 202 nts=3 AAA A.A2467,A.A2466,A.A2662 203 nts=3 AAC A.A2469,A.A2468,A.C3162 204 nts=3 CAC A.C2511,A.A2512,A.C2513 205 nts=3 AAG A.A2518,A.A2530,A.G2519 206 nts=3 GUC A.G2542,A.U2638,A.C2639 207 nts=3 CUU A.C2612,A.U2613,A.U2614 208 nts=3 AAG A.A2617,A.A2619,A.G2620 209 nts=3 CAC A.C2640,A.A2641,A.C2642 210 nts=3 GUU A.G2655,A.U2660,A.U2661 211 nts=3 UUA A.U2666,A.U2667,A.A2668 212 nts=3 GAU A.G2686,A.A2704,A.U2705 213 nts=3 GUG A.G2690,A.U2691,A.G2692 214 nts=3 AGU A.A2757,A.G2758,A.U2759 215 nts=3 ACC A.A2792,A.C2793,A.C2794 216 nts=3 AUU A.A2798,A.U2799,A.U2800 217 nts=3 UUC A.U2807,A.U2808,A.C2809 218 nts=3 AAC A.A2837,A.A2838,A.C2840 219 nts=3 UAG A.U2966,A.A2965,A.G3016 220 nts=3 AUC A.A2997,A.U2998,A.C2999 221 nts=3 AGU A.A3000,A.G3061,A.U3062 222 nts=3 UCA A.U3042,A.C3043,A.A3044 223 nts=3 AUU A.A3048,A.U3049,A.U3050 224 nts=3 UGU A.U3067,A.G3068,A.U3097 225 nts=3 GGG A.G3075,A.G3094,A.G3095 226 nts=3 UAC A.U3104,A.A3105,A.C3106 227 nts=3 AAA A.A3128,A.A3129,A.A3130 228 nts=3 GAA A.G3139,A.A3140,A.A3141 229 nts=3 UAC A.U3150,A.A3151,A.C3152 230 nts=3 CCC A.C3169,A.C3170,A.C3171 231 nts=3 CGA A.C3172,A.G3196,A.A3195 232 nts=3 UAU A.U3178,A.A3177,A.U3193 233 nts=3 ACW A.A3213,A.C3212,E.TRP48 234 nts=3 CAG A.C3216,A.A3218,A.G3219 235 nts=3 AGA B.A1603,B.G1669,B.A1670 236 nts=3 GAC B.G1611,B.A1625,B.C1626 237 nts=3 AAA B.A1616,B.A1615,B.A1622 238 nts=3 ACU B.A1630,B.C1631,B.U1632 239 nts=3 UAG B.U1639,B.A1640,B.G1641 240 nts=3 QAY D.GLN205,A.A2521,5.TYR31 241 nts=3 HAR E.HIS292,A.A3217,Q.ARG86 242 nts=3 FUW R.PHE128,A.U2244,S.TRP61 243 nts=3 RAH 5.ARG110,A.A2406,5.HIS302 244 nts=3 YAF s.TYR94,A.A2374,s.PHE98 245 nts=4 ACCR A.A1692,A.C1691,A.C1690,Y.ARG213 246 nts=4 CCAC A.C1695,A.C1696,A.A1697,A.C1698 247 nts=4 CCAH A.C1838,A.C1837,A.A1836,a.HIS126 248 nts=4 CAAU A.C1910,A.A1909,A.A2012,A.U2013 249 nts=4 CAAG A.C1942,A.A1943,A.A1971,A.G1970 250 nts=4 AGCC A.A1994,A.G2002,A.C2927,A.C2928 251 nts=4 AGCC A.A2027,A.G2028,A.C2263,A.C2125 252 nts=4 CCAR A.C2067,A.C2066,A.A2065,W.ARG74 253 nts=4 ACAC A.A2109,A.C2111,A.A2112,A.C2114 254 nts=4 UAAU A.U2168,A.A2196,A.A2195,A.U2194 255 nts=4 AAAA A.A2230,A.A3005,A.A2231,A.A2232 256 nts=4 CAAR A.C2247,A.A2246,A.A2245,r.ARG189 257 nts=4 CACA A.C2282,A.A2281,A.C2280,A.A2286 258 nts=4 AAAR A.A2290,A.A2291,A.A2293,M.ARG39 259 nts=4 UCUU A.U2387,A.C2386,A.U2407,A.U2408 260 nts=4 ACAA A.A2425,A.C2344,A.A2363,A.A2432 261 nts=4 AUAG A.A2444,A.U2445,A.A2447,A.G2448 262 nts=4 GAUC A.G2478,A.A2472,A.U2656,A.C2657 263 nts=4 CCCC A.C2494,A.C2493,A.C2540,A.C2541 264 nts=4 CUCU A.C2548,A.U2563,A.C2549,A.U2562 265 nts=4 GUAU A.G2574,A.U2575,A.A2581,A.U2580 266 nts=4 CGAA A.C2597,A.G2596,A.A2595,A.A2632 267 nts=4 CAAY A.C2708,A.A2707,A.A2706,a.TYR124 268 nts=4 UUAA A.U2739,A.U3083,A.A3084,A.A3085 269 nts=4 UAAA A.U2750,A.A2749,A.A2748,A.A2801 270 nts=4 AAAC A.A2753,A.A2754,A.A2755,A.C2756 271 nts=4 AGAC A.A2845,A.G2846,A.A2913,A.C2911 272 nts=4 GUAC A.G2849,A.U2850,A.A2851,A.C2852 273 nts=4 AACU A.A2904,A.A2905,A.C2906,A.U2907 274 nts=4 ACAA A.A2919,A.C2920,A.A1727,A.A2921 275 nts=4 AGCC A.A2958,A.G2959,A.C2962,A.C2961 276 nts=4 GAGU A.G2995,A.A3069,A.G3070,A.U3071 277 nts=4 AGCC A.A3018,A.G3019,A.C3020,A.C3021 278 nts=5 GAUAR A.G1671,A.A1818,A.U1819,A.A1820,a.ARG128 279 nts=5 AAACG A.A1688,A.A1687,A.A1686,A.C1685,A.G1767 280 nts=5 UAGCC A.U1717,A.A1718,A.G1719,A.C1720,A.C1721 281 nts=5 AAAAU A.A1801,A.A1802,A.A1805,A.A1803,A.U1806 282 nts=5 AUAAC A.A1871,A.U1872,A.A1873,A.A1874,A.C1875 283 nts=5 UAAGA A.U1878,A.A1897,A.A1898,A.G1899,A.A1900 284 nts=5 GACAC A.G1932,A.A1931,A.C1944,A.A1945,A.C1946 285 nts=5 GGGCC A.G1987,A.G1985,A.G2004,A.C2005,A.C2006 286 nts=5 GAAAU A.G2022,A.A2294,A.A2273,A.A2274,A.U2275 287 nts=5 ACCCA A.A2163,A.C2164,A.C2165,A.C2166,A.A2167 288 nts=5 AAAAG A.A2178,A.A2179,A.A2180,A.A2184,A.G2185 289 nts=5 UCAAG A.U2205,A.C2206,A.A2207,A.A2208,A.G2209 290 nts=5 AAACH A.A2237,A.A2238,A.A2239,A.C2240,r.HIS196 291 nts=5 AACRC A.A2381,A.A2412,A.C2413,s.ARG162,A.C2414 292 nts=5 AUAAG A.A2394,A.U2392,A.A2391,A.A2390,A.G2403 293 nts=5 GACCY A.G2435,A.A2429,A.C2433,A.C2431,T.TYR158 294 nts=5 UAACU A.U2499,A.A2503,A.A3074,A.C2502,A.U3096 295 nts=5 AAAGC A.A2550,A.A2590,A.A2591,A.G2592,A.C2570 296 nts=5 UCACA A.U2606,A.C2605,A.A2604,A.C2603,A.A2629 297 nts=5 CAACA A.C2727,A.A2937,A.A2938,A.C2939,A.A2940 298 nts=5 ACUAA A.A2848,A.C2847,A.U2894,A.A2893,A.A2892 299 nts=5 CUAAC A.C2856,A.U2857,A.A2858,A.A2873,A.C2872 300 nts=5 GAAAG A.G2860,A.A2859,A.A2874,A.A2875,A.G2876 301 nts=5 ACCAG A.A2866,A.C2867,A.C2868,A.A2869,A.G2870 302 nts=5 CGAAC A.C2877,A.G2878,A.A2879,A.A2880,A.C2881 303 nts=5 GCAAG A.G2896,A.C2912,A.A2910,A.A3301,A.G2909 304 nts=5 CCUAG A.C2900,A.C2899,A.U2898,A.A2897,A.G2917 305 nts=5 GCAGG A.G2943,A.C2944,A.A2945,A.G2977,A.G2976 306 nts=5 CUAAC A.C2948,A.U2947,A.A2946,A.A2981,A.C2982 307 nts=5 GAACA A.G2957,A.A2956,A.A2969,A.C2970,A.A2971 308 nts=5 CAUAU A.C3004,A.A3029,A.U3006,A.A3028,A.U3027 309 nts=5 CCCUU A.C3119,A.C3120,A.C3121,A.U3122,A.U3124 310 nts=5 FAAUY o.PHE26,A.A2155,A.A2156,A.U2157,r.TYR195 311 nts=6 AUAAAU A.A1737,A.U1738,A.A1739,A.A1740,A.A1741,A.U1743 312 nts=6 AACUCU A.A1790,A.A1789,A.C1788,A.U1998,A.C1919,A.U1920 313 nts=6 AAUAAU A.A1860,A.A2306,A.U2307,A.A2308,A.A2309,A.U2311 314 nts=6 AAAGCG A.A1908,A.A1907,A.A2014,A.G1906,A.C1905,A.G2018 315 nts=6 CCCCCG A.C2076,A.C2077,A.C2078,A.C2059,A.C2058,A.G2082 316 nts=6 CAAAAU A.C2123,A.A2124,A.A2029,A.A2264,A.A2265,A.U2266 317 nts=6 CCGAAA A.C2341,A.C2340,A.G2339,A.A2338,A.A2337,A.A2438 318 nts=6 CAUACG A.C2508,A.A2509,A.U2510,A.A2539,A.C2538,A.G2537 319 nts=6 UGCCAR A.U2529,A.G2528,A.C2526,A.C2525,A.A2524,D.ARG92 320 nts=6 GCAAAG A.G2712,A.C2713,A.A2714,A.A3101,A.A3064,A.G2719 321 nts=6 AGAAGC A.A2720,A.G2721,A.A2722,A.A2990,A.G2724,A.C2726 322 nts=6 GGGCGA A.G2815,A.G2816,A.G2817,A.C2818,A.G2819,A.A2820 323 nts=6 UCUAUR A.U2953,A.C2954,A.U2955,A.A2963,A.U2964,4.ARG75 324 nts=6 CAUGUC A.C3184,A.A3185,A.U3186,A.G3179,A.U3188,A.C3192 325 nts=6 AUACCC A.A3201,A.U3202,A.A3203,A.C3204,A.C3205,A.C3206 326 nts=6 UACACU B.U1633,B.A1634,B.C1635,B.A1636,B.C1637,B.U1638 327 nts=7 UAACCAC A.U1730,A.A1722,A.A1723,A.C1726,A.C1725,A.A2918,A.C2036 328 nts=7 CAAAAUR A.C1785,A.A1784,A.A1794,A.A1795,A.A1796,A.U1780,V.ARG40 329 nts=7 GACGAAA A.G1913,A.A1914,A.C1915,A.G1916,A.A1984,A.A1917,A.A1921 330 nts=7 UUAAGAA A.U2038,A.U2035,A.A2034,A.A2033,A.G2032,A.A2044,A.A2045 331 nts=7 GACACUU A.G2063,A.A2062,A.C2061,A.A2060,A.C2079,A.U2080,A.U2081 332 nts=7 ARAAAAC A.A2154,o.ARG30,A.A2153,A.A2152,A.A2151,A.A2250,A.C2252 333 nts=7 CAAUAAA A.C2162,A.A2161,A.A3182,A.U3181,A.A3180,A.A3190,A.A3191 334 nts=7 AAAAAUU A.A2313,A.A2312,A.A2676,A.A2677,A.A2678,A.U2679,A.U2680 335 nts=7 GCACCCA A.G2828,A.C2829,A.A2830,A.C2836,A.C2835,A.C2834,A.A2833 336 nts=7 GCGUCGC A.G2933,A.C2988,A.G2934,A.U2987,A.C2986,A.G2941,A.C2942 337 nts=7 GAGAAAU B.G1642,B.A1643,B.G1644,B.A1610,B.A1645,B.A1621,B.U1646 338 nts=8 AAUGGGGG A.A1777,A.A1779,A.U1778,A.G1782,A.G1793,A.G1792,A.G1791,A.G1787 339 nts=8 UGACAUGA A.U1850,A.G1851,A.A2693,A.C1852,A.A1856,A.U1857,A.G1858,A.A1859 340 nts=8 AAACUCUR A.A2303,A.A1863,A.A1864,A.C1865,A.U1866,A.C2295,A.U2021,M.ARG41 341 nts=8 GGUCGACU A.G2470,A.G2471,A.U2654,A.C2653,A.G2652,A.A2651,A.C2650,A.U2486 342 nts=8 UCUAAACH A.U2485,A.C2484,A.U2483,A.A2482,A.A2481,A.A2480,A.C2479,E.HIS231 343 nts=8 CGGUGACC A.C2569,A.G2593,A.G2631,A.U2630,A.G2627,A.A2598,A.C2625,A.C2624 344 nts=8 GCAACAAG A.G3127,A.C3126,A.A3125,A.A3133,A.C3134,A.A3135,A.A3136,A.G3137 345 nts=9 UAAAAUUGW A.U1745,A.A1744,A.A1755,A.A1756,A.A1757,A.U1758,A.U1759,A.G1760,q.TRP50 346 nts=9 AAAAAACAG A.A2461,A.A2460,A.A2459,A.A2458,A.A3220,A.A3221,A.C3222,A.A3223,A.G3224 347 nts=9 YACAACCAH D.TYR131,A.A2402,A.C2400,A.A2399,A.A2398,A.C2397,A.C2396,A.A2395,5.HIS385 348 nts=10 CUUCCAGACU A.C1849,A.U1848,A.U1847,A.C1846,A.C1845,A.A1844,A.G2681,A.A2682,A.C2683,A.U2685 349 nts=10 CGAGAACACC A.C2183,A.G2182,A.A2199,A.G2197,A.A2213,A.A2214,A.C2215,A.A2216,A.C2217,A.C2218 350 nts=11 CUAAACAGAAG A.C1672,A.U1673,A.A1674,A.A1675,A.A1676,A.C1677,A.A1798,A.G1797,A.A1773,A.A1680,A.G1681 **************************************************************************** Nucleotides not involved in stacking interactions nts=113 CUCAGCCUCUUUGAUCAAGAACACUAACUUUUUUUCUAAUUAUCCCGUCCCCUCUCUCCAAAACUACAUUUUUACAUAACUCCUUAUUUUCUCCACUUUUGCACAUCUUCUUU A.C1689,A.U1694,A.C1699,A.A1708,A.G1709,A.C1711,A.C1715,A.U1716,A.C1732,A.U1752,A.U1774,A.U1799,A.G1800,A.A1804,A.U1809,A.C1813,A.A1855,A.A1887,A.G1888,A.A1957,A.A1986,A.C2000,A.A2003,A.C2024,A.U2030,A.A2031,A.A2039,A.C2043,A.U2048,A.U2049,A.U2088,A.U2089,A.U2118,A.U2119,A.U2126,A.C2136,A.U2141,A.A2142,A.A2146,A.U2158,A.U2159,A.A2160,A.U2242,A.C2276,A.C2283,A.C2284,A.G2292,A.U2316,A.C2331,A.C2332,A.C2364,A.C2393,A.U2404,A.C2405,A.U2411,A.C2415,A.U2416,A.C2417,A.C2427,A.A2430,A.A2451,A.A2452,A.A2500,A.C2520,A.U2522,A.A2527,A.C2557,A.A2558,A.U2607,A.U2618,A.U2626,A.U2628,A.U2634,A.A2644,A.C2718,A.A2725,A.U2731,A.A2745,A.A2760,A.C2839,A.U2854,A.C2865,A.C2889,A.U2895,A.U2908,A.A2926,A.U2936,A.U2960,A.U2978,A.U2991,A.C3060,A.U3072,A.C3073,A.C3087,A.A3089,A.C3093,A.U3100,A.U3108,A.U3109,A.U3115,A.G3123,A.C3149,A.A3156,A.C3157,A.A3207,A.U3228,B.C1601,B.U1609,B.U1614,B.C1649,B.U1658,B.U1659,B.U1668 **************************************************************************** List of 90 atom-base capping interactions dv: vertical distance of the atom above the nucleotide base ----------------------------------------------------------- type atom nt dv 1 phosphate OP2@A.A1789 A.G1787 2.86 2 sugar O4'@A.A1825 A.G1826 3.29 3 sugar O4'@A.A1832 A.G1831 3.21 4 phosphate OP2@A.A1835 A.C1833 2.77 5 sugar O4'@A.C2699 A.U1843 3.01 6 phosphate OP2@A.G1851 A.C1849 2.78 7 sugar O2'@A.A2693 A.U1854 2.92 8 sugar O4'@A.G2681 A.A1859 2.78 9 sugar O4'@A.C1903 A.G1868 3.08 10 other SG@M.CYS49 A.G1868 3.16 11 sugar O4'@A.A1909 A.A1908 3.42 12 sugar O4'@A.U1998 A.C1919 3.14 13 sugar O4'@A.G1932 A.A1931 3.34 14 phosphate O3'@A.U3098 A.U1956 3.25 15 sugar O2'@A.A2677 A.A1957 2.94 16 sugar O2'@A.G1958 A.C1959 3.45 17 sugar O4'@A.C2501 A.A1962 2.96 18 sugar O4'@A.A1972 A.G1973 3.15 19 sugar O4'@A.C1992 A.A1993 2.90 20 sugar O4'@A.A2012 A.U2010 2.88 21 phosphate OP1@A.U2731 A.G2015 3.29 22 phosphate OP2@A.C2036 A.U2037 3.02 23 sugar O4'@A.A2074 A.A2073 3.41 24 sugar O4'@A.A2946 A.A2109 2.73 25 sugar O4'@A.C2114 A.A2112 3.35 26 sugar O2'@A.A2131 A.A2132 2.81 27 sugar O4'@A.U2141 A.A2142 3.18 28 phosphate OP2@A.A2179 A.U2177 2.79 29 phosphate O5'@A.A2207 A.A2181 3.30 30 sugar O4'@A.A2207 A.A2181 3.35 31 phosphate OP2@A.C2206 A.U2204 2.94 32 sugar O4'@A.A2208 A.A2207 3.47 33 sugar O4'@A.A2214 A.A2213 3.48 34 sugar O4'@A.C3057 A.A2232 2.91 35 phosphate OP1@A.C2689 A.U2233 3.40 36 sugar O4'@A.G2022 A.A2294 3.29 37 sugar O4'@A.C1846 A.A2297 3.22 38 sugar O2'@A.U2296 A.A2297 3.24 39 sugar O4'@A.U2342 A.G2343 3.10 40 sugar O4'@A.C2423 A.U2371 2.70 41 sugar O4'@A.A2402 A.G2403 3.07 42 sugar O2'@A.U2404 A.C2405 2.99 43 phosphate OP1@A.U2372 A.U2422 2.99 44 phosphate O3'@A.C2443 A.A2444 3.09 45 phosphate OP2@A.A2444 A.A2444 3.00 46 sugar O2'@A.G2317 A.A2452 3.24 47 sugar O4'@A.A3220 A.A2458 3.19 48 sugar O4'@A.A2472 A.A2473 3.07 49 phosphate OP2@A.G2477 A.U2475 2.90 50 sugar O4'@A.A3069 A.C2476 2.77 51 sugar O2'@A.C2493 A.G2492 3.07 52 sugar O4'@A.C2494 A.C2493 3.48 53 sugar O4'@A.A2530 A.U2532 3.00 54 sugar O4'@A.C2583 A.A2582 3.10 55 sugar O2'@A.A2598 A.A2600 2.86 56 phosphate OP2@A.A2616 A.U2614 2.78 57 sugar O4'@A.U3037 A.A2616 2.82 58 sugar O4'@A.C2603 A.A2629 3.02 59 sugar O4'@A.U1950 A.A2644 2.91 60 sugar O4'@A.G1969 A.A2644 2.79 61 phosphate OP1@A.C3162 A.C2659 3.42 62 sugar O4'@A.A1860 A.U2680 3.15 63 sugar O4'@A.C2683 A.A2682 3.25 64 sugar O4'@A.C1725 A.U2731 2.69 65 phosphate OP1@A.G2816 A.U2813 3.06 66 sugar O2'@A.U2117 A.A2837 3.48 67 phosphate OP2@A.A2905 A.U2903 2.97 68 sugar O4'@A.C2911 A.A2913 2.93 69 sugar O4'@A.U2823 A.C2915 3.23 70 sugar O4'@A.A2913 A.C2915 2.80 71 sugar O2'@A.A2034 A.G2916 3.42 72 sugar O4'@A.G2916 A.G2917 3.31 73 sugar O2'@A.U2808 A.A2921 3.31 74 phosphate O5'@A.C3073 A.A2926 3.49 75 sugar O4'@A.C2928 A.C2927 3.29 76 sugar O4'@A.G2957 A.A2956 3.32 77 sugar O4'@A.U2966 A.A2965 3.29 78 phosphate OP1@A.A2937 A.A2984 3.36 79 sugar O2'@A.U1857 A.G2989 3.11 80 other P@A.U3041 A.U3039 3.37 81 phosphate OP2@A.U3041 A.U3039 2.79 82 sugar O2'@A.G3070 A.G3040 3.13 83 sugar O4'@A.C3043 A.U3042 3.37 84 sugar O4'@A.U3049 A.A3048 3.34 85 sugar O4'@A.G3061 A.U3058 2.98 86 phosphate OP2@A.A3084 A.G3082 2.86 87 sugar O4'@A.C2502 A.U3096 3.25 88 sugar O4'@A.C3155 A.U3154 3.44 89 other P@B.A1634 B.U1632 3.41 90 phosphate OP2@B.A1634 B.U1632 2.90 **************************************************************************** Note: for the various types of loops listed below, numbers within the first set of brackets are the number of loop nts, and numbers in the second set of brackets are the identities of the stems (positive number) or isolated WC/wobble pairs (negative numbers) to which they are linked. **************************************************************************** List of 38 hairpin loops 1 hairpin loop: nts=8; [6]; linked by [#-2] summary: [1] 6 [A.1722 A.1729] 1 nts=8 AAACCAUU A.A1722,A.A1723,A.A1724,A.C1725,A.C1726,A.A1727,A.U1728,A.U1729 nts=6 AACCAU A.A1723,A.A1724,A.C1725,A.C1726,A.A1727,A.U1728 2 hairpin loop: nts=7; [5]; linked by [#4] summary: [1] 5 [A.1746 A.1752] 2 nts=7 AGGCGAU A.A1746,A.G1747,A.G1748,A.C1749,A.G1750,A.A1751,A.U1752 nts=5 GGCGA A.G1747,A.G1748,A.C1749,A.G1750,A.A1751 3 hairpin loop: nts=6; [4]; linked by [#5] summary: [1] 4 [A.1786 A.1791] 2 nts=6 CGCAAG A.C1786,A.G1787,A.C1788,A.A1789,A.A1790,A.G1791 nts=4 GCAA A.G1787,A.C1788,A.A1789,A.A1790 4 hairpin loop: nts=5; [3]; linked by [#-5] summary: [1] 3 [A.1803 A.1807] 1 nts=5 AAAUU A.A1803,A.A1804,A.A1805,A.U1806,A.U1807 nts=3 AAU A.A1804,A.A1805,A.U1806 5 hairpin loop: nts=9; [7]; linked by [#6] summary: [1] 7 [A.1831 A.1839] 3 nts=9 GACUAACCC A.G1831,A.A1832,A.C1833,A.U1834,A.A1835,A.A1836,A.C1837,A.C1838,A.C1839 nts=7 ACUAACC A.A1832,A.C1833,A.U1834,A.A1835,A.A1836,A.C1837,A.C1838 6 hairpin loop: nts=10; [8]; linked by [#-9] summary: [1] 8 [A.1847 A.1856] 1 nts=10 UUCUGCAUAA A.U1847,A.U1848,A.C1849,A.U1850,A.G1851,A.C1852,A.A1853,A.U1854,A.A1855,A.A1856 nts=8 UCUGCAUA A.U1848,A.C1849,A.U1850,A.G1851,A.C1852,A.A1853,A.U1854,A.A1855 7 hairpin loop: nts=6; [4]; linked by [#9] summary: [1] 4 [A.1884 A.1889] 2 nts=6 GAGAGC A.G1884,A.A1885,A.G1886,A.A1887,A.G1888,A.C1889 nts=4 AGAG A.A1885,A.G1886,A.A1887,A.G1888 8 hairpin loop: nts=10; [8]; linked by [#16] summary: [1] 8 [A.1954 A.1963] 4 nts=10 UGUAGCAAAA A.U1954,A.G1955,A.U1956,A.A1957,A.G1958,A.C1959,A.A1960,A.A1961,A.A1962,A.A1963 nts=8 GUAGCAAA A.G1955,A.U1956,A.A1957,A.G1958,A.C1959,A.A1960,A.A1961,A.A1962 9 hairpin loop: nts=9; [7]; linked by [#17] summary: [1] 7 [A.1988 A.1996] 2 nts=9 GCGACAAAC A.G1988,A.C1989,A.G1990,A.A1991,A.C1992,A.A1993,A.A1994,A.A1995,A.C1996 nts=7 CGACAAA A.C1989,A.G1990,A.A1991,A.C1992,A.A1993,A.A1994,A.A1995 10 hairpin loop: nts=6; [4]; linked by [#-22] summary: [1] 4 [A.2035 A.2040] 1 nts=6 UCUUAG A.U2035,A.C2036,A.U2037,A.U2038,A.A2039,A.G2040 nts=4 CUUA A.C2036,A.U2037,A.U2038,A.A2039 11 hairpin loop: nts=8; [6]; linked by [#23] summary: [1] 6 [A.2107 A.2114] 10 nts=8 GGAACAGC A.G2107,A.G2108,A.A2109,A.A2110,A.C2111,A.A2112,A.G2113,A.C2114 nts=6 GAACAG A.G2108,A.A2109,A.A2110,A.C2111,A.A2112,A.G2113 12 hairpin loop: nts=8; [6]; linked by [#24] summary: [1] 6 [A.2129 A.2136] 3 nts=8 GAAAAAAC A.G2129,A.A2130,A.A2131,A.A2132,A.A2133,A.A2134,A.A2135,A.C2136 nts=6 AAAAAA A.A2130,A.A2131,A.A2132,A.A2133,A.A2134,A.A2135 13 hairpin loop: nts=11; [9]; linked by [#27] summary: [1] 9 [A.2175 A.2185] 3 nts=11 CCUAAAAGCAG A.C2175,A.C2176,A.U2177,A.A2178,A.A2179,A.A2180,A.A2181,A.G2182,A.C2183,A.A2184,A.G2185 nts=9 CUAAAAGCA A.C2176,A.U2177,A.A2178,A.A2179,A.A2180,A.A2181,A.G2182,A.C2183,A.A2184 14 hairpin loop: nts=8; [6]; linked by [#28] summary: [1] 6 [A.2202 A.2209] 3 nts=8 CGUUCAAG A.C2202,A.G2203,A.U2204,A.U2205,A.C2206,A.A2207,A.A2208,A.G2209 nts=6 GUUCAA A.G2203,A.U2204,A.U2205,A.C2206,A.A2207,A.A2208 15 hairpin loop: nts=8; [6]; linked by [#29] summary: [1] 6 [A.2279 A.2286] 5 nts=8 UCACCCUA A.U2279,A.C2280,A.A2281,A.C2282,A.C2283,A.C2284,A.U2285,A.A2286 nts=6 CACCCU A.C2280,A.A2281,A.C2282,A.C2283,A.C2284,A.U2285 16 hairpin loop: nts=6; [4]; linked by [#31] summary: [1] 4 [A.2319 A.2324] 3 nts=6 AAACAU A.A2319,A.A2320,A.A2321,A.C2322,A.A2323,A.U2324 nts=4 AACA A.A2320,A.A2321,A.C2322,A.A2323 17 hairpin loop: nts=4; [2]; linked by [#-30] summary: [1] 2 [A.2400 A.2403] 1 nts=4 CAAG A.C2400,A.A2401,A.A2402,A.G2403 nts=2 AA A.A2401,A.A2402 18 hairpin loop: nts=8; [6]; linked by [#37] summary: [1] 6 [A.2428 A.2435] 2 nts=8 CAACACAG A.C2428,A.A2429,A.A2430,A.C2431,A.A2432,A.C2433,A.A2434,A.G2435 nts=6 AACACA A.A2429,A.A2430,A.C2431,A.A2432,A.C2433,A.A2434 19 hairpin loop: nts=11; [9]; linked by [#43] summary: [1] 9 [A.2497 A.2507] 2 nts=11 UUUACCAAAAA A.U2497,A.U2498,A.U2499,A.A2500,A.C2501,A.C2502,A.A2503,A.A2504,A.A2505,A.A2506,A.A2507 nts=9 UUACCAAAA A.U2498,A.U2499,A.A2500,A.C2501,A.C2502,A.A2503,A.A2504,A.A2505,A.A2506 20 hairpin loop: nts=15; [13]; linked by [#44] summary: [1] 13 [A.2518 A.2532] 6 nts=15 AGCAUCACCAGUAUU A.A2518,A.G2519,A.C2520,A.A2521,A.U2522,A.C2523,A.A2524,A.C2525,A.C2526,A.A2527,A.G2528,A.U2529,A.A2530,A.U2531,A.U2532 nts=13 GCAUCACCAGUAU A.G2519,A.C2520,A.A2521,A.U2522,A.C2523,A.A2524,A.C2525,A.C2526,A.A2527,A.G2528,A.U2529,A.A2530,A.U2531 21 hairpin loop: nts=4; [2]; linked by [#48] summary: [1] 2 [A.2556 A.2559] 4 nts=4 ACAU A.A2556,A.C2557,A.A2558,A.U2559 nts=2 CA A.C2557,A.A2558 22 hairpin loop: nts=9; [7]; linked by [#50] summary: [1] 7 [A.2612 A.2620] 5 nts=9 CUUAAAUAG A.C2612,A.U2613,A.U2614,A.A2615,A.A2616,A.A2617,A.U2618,A.A2619,A.G2620 nts=7 UUAAAUA A.U2613,A.U2614,A.A2615,A.A2616,A.A2617,A.U2618,A.A2619 23 hairpin loop: nts=15; [13]; linked by [#-36] summary: [1] 13 [A.2683 A.2697] 1 nts=15 CCUGCCCGUGAAGAG A.C2683,A.C2684,A.U2685,A.G2686,A.C2687,A.C2688,A.C2689,A.G2690,A.U2691,A.G2692,A.A2693,A.A2694,A.G2695,A.A2696,A.G2697 nts=13 CUGCCCGUGAAGA A.C2684,A.U2685,A.G2686,A.C2687,A.C2688,A.C2689,A.G2690,A.U2691,A.G2692,A.A2693,A.A2694,A.G2695,A.A2696 24 hairpin loop: nts=10; [8]; linked by [#51] summary: [1] 8 [A.2690 A.2699] 5 nts=10 GUGAAGAGGC A.G2690,A.U2691,A.G2692,A.A2693,A.A2694,A.G2695,A.A2696,A.G2697,A.G2698,A.C2699 nts=8 UGAAGAGG A.U2691,A.G2692,A.A2693,A.A2694,A.G2695,A.A2696,A.G2697,A.G2698 25 hairpin loop: nts=9; [7]; linked by [#61] summary: [1] 7 [A.2812 A.2820] 3 nts=9 UUGGGGCGA A.U2812,A.U2813,A.G2814,A.G2815,A.G2816,A.G2817,A.C2818,A.G2819,A.A2820 nts=7 UGGGGCG A.U2813,A.G2814,A.G2815,A.G2816,A.G2817,A.C2818,A.G2819 26 hairpin loop: nts=21; [19]; linked by [#-38] summary: [1] 19 [A.2819 A.2839] 1 nts=21 GACCUCGGAGCAGAACCCAAC A.G2819,A.A2820,A.C2821,A.C2822,A.U2823,A.C2824,A.G2825,A.G2826,A.A2827,A.G2828,A.C2829,A.A2830,A.G2831,A.A2832,A.A2833,A.C2834,A.C2835,A.C2836,A.A2837,A.A2838,A.C2839 nts=19 ACCUCGGAGCAGAACCCAA A.A2820,A.C2821,A.C2822,A.U2823,A.C2824,A.G2825,A.G2826,A.A2827,A.G2828,A.C2829,A.A2830,A.G2831,A.A2832,A.A2833,A.C2834,A.C2835,A.C2836,A.A2837,A.A2838 27 hairpin loop: nts=13; [11]; linked by [#62] summary: [1] 11 [A.2828 A.2840] 6 nts=13 GCAGAACCCAACC A.G2828,A.C2829,A.A2830,A.G2831,A.A2832,A.A2833,A.C2834,A.C2835,A.C2836,A.A2837,A.A2838,A.C2839,A.C2840 nts=11 CAGAACCCAAC A.C2829,A.A2830,A.G2831,A.A2832,A.A2833,A.C2834,A.C2835,A.C2836,A.A2837,A.A2838,A.C2839 28 hairpin loop: nts=9; [7]; linked by [#65] summary: [1] 7 [A.2862 A.2870] 3 nts=9 CUUCACCAG A.C2862,A.U2863,A.U2864,A.C2865,A.A2866,A.C2867,A.C2868,A.A2869,A.G2870 nts=7 UUCACCA A.U2863,A.U2864,A.C2865,A.A2866,A.C2867,A.C2868,A.A2869 29 hairpin loop: nts=6; [4]; linked by [#66] summary: [1] 4 [A.2902 A.2907] 3 nts=6 AUAACU A.A2902,A.U2903,A.A2904,A.A2905,A.C2906,A.U2907 nts=4 UAAC A.U2903,A.A2904,A.A2905,A.C2906 30 hairpin loop: nts=9; [7]; linked by [#69] summary: [1] 7 [A.2958 A.2966] 2 nts=9 AGUCCAUAU A.A2958,A.G2959,A.U2960,A.C2961,A.C2962,A.A2963,A.U2964,A.A2965,A.U2966 nts=7 GUCCAUA A.G2959,A.U2960,A.C2961,A.C2962,A.A2963,A.U2964,A.A2965 31 hairpin loop: nts=8; [6]; linked by [#73] summary: [1] 6 [A.3015 A.3022] 6 nts=8 UGCAGCCG A.U3015,A.G3016,A.C3017,A.A3018,A.G3019,A.C3020,A.C3021,A.G3022 nts=6 GCAGCC A.G3016,A.C3017,A.A3018,A.G3019,A.C3020,A.C3021 32 hairpin loop: nts=7; [5]; linked by [#74] summary: [1] 5 [A.3038 A.3044] 5 nts=7 UUGUUCA A.U3038,A.U3039,A.G3040,A.U3041,A.U3042,A.C3043,A.A3044 nts=5 UGUUC A.U3039,A.G3040,A.U3041,A.U3042,A.C3043 33 hairpin loop: nts=6; [4]; linked by [#76] summary: [1] 4 [A.3081 A.3086] 3 nts=6 AGUAAU A.A3081,A.G3082,A.U3083,A.A3084,A.A3085,A.U3086 nts=4 GUAA A.G3082,A.U3083,A.A3084,A.A3085 34 hairpin loop: nts=6; [4]; linked by [#-46] summary: [1] 4 [A.3126 A.3131] 1 nts=6 CGAAAG A.C3126,A.G3127,A.A3128,A.A3129,A.A3130,A.G3131 nts=4 GAAA A.G3127,A.A3128,A.A3129,A.A3130 35 hairpin loop: nts=6; [4]; linked by [#80] summary: [1] 4 [A.3154 A.3159] 3 nts=6 UCACAA A.U3154,A.C3155,A.A3156,A.C3157,A.A3158,A.A3159 nts=4 CACA A.C3155,A.A3156,A.C3157,A.A3158 36 hairpin loop: nts=18; [16]; linked by [#81] summary: [1] 16 [A.3176 A.3193] 3 nts=18 AAUGAUAUCAUCUCAACU A.A3176,A.A3177,A.U3178,A.G3179,A.A3180,A.U3181,A.A3182,A.U3183,A.C3184,A.A3185,A.U3186,A.C3187,A.U3188,A.C3189,A.A3190,A.A3191,A.C3192,A.U3193 nts=16 AUGAUAUCAUCUCAAC A.A3177,A.U3178,A.G3179,A.A3180,A.U3181,A.A3182,A.U3183,A.C3184,A.A3185,A.U3186,A.C3187,A.U3188,A.C3189,A.A3190,A.A3191,A.C3192 37 hairpin loop: nts=9; [7]; linked by [#82] summary: [1] 7 [A.3216 A.3224] 4 nts=9 CAAGAACAG A.C3216,A.A3217,A.A3218,A.G3219,A.A3220,A.A3221,A.C3222,A.A3223,A.G3224 nts=7 AAGAACA A.A3217,A.A3218,A.G3219,A.A3220,A.A3221,A.C3222,A.A3223 38 hairpin loop: nts=9; [7]; linked by [#86] summary: [1] 7 [B.1630 B.1638] 2 nts=9 ACUUACACU B.A1630,B.C1631,B.U1632,B.U1633,B.A1634,B.C1635,B.A1636,B.C1637,B.U1638 nts=7 CUUACAC B.C1631,B.U1632,B.U1633,B.A1634,B.C1635,B.A1636,B.C1637 **************************************************************************** List of 25 bulges 1 bulge: nts=5; [0,1]; linked by [#2,#3] summary: [2] 0 1 [A.1682 A.1770 A.1683 A.1768] 2 2 nts=5 CCGCG A.C1682,A.C1683,A.G1768,A.C1769,A.G1770 nts=0 nts=1 C A.C1769 2 bulge: nts=5; [0,1]; linked by [#7,#-10] summary: [2] 0 1 [A.1862 A.2303 A.1863 A.2301] 3 1 nts=5 UAUUA A.U1862,A.A1863,A.U2301,A.U2302,A.A2303 nts=0 nts=1 U A.U2302 3 bulge: nts=5; [1,0]; linked by [#-10,#-11] summary: [2] 1 0 [A.1863 A.2301 A.1865 A.2300] 1 1 nts=5 AACGU A.A1863,A.A1864,A.C1865,A.G2300,A.U2301 nts=1 A A.A1864 nts=0 4 bulge: nts=5; [0,1]; linked by [#-12,#-13] summary: [2] 0 1 [A.1875 A.1899 A.1876 A.1897] 1 1 nts=5 CUAAG A.C1875,A.U1876,A.A1897,A.A1898,A.G1899 nts=0 nts=1 A A.A1898 5 bulge: nts=5; [0,1]; linked by [#13,#-16] summary: [2] 0 1 [A.1929 A.1975 A.1930 A.1973] 3 1 nts=5 ACGAU A.A1929,A.C1930,A.G1973,A.A1974,A.U1975 nts=0 nts=1 A A.A1974 6 bulge: nts=5; [0,1]; linked by [#-20,#-21] summary: [2] 0 1 [A.2032 A.2043 A.2033 A.2041] 1 1 nts=5 GAUUC A.G2032,A.A2033,A.U2041,A.U2042,A.C2043 nts=0 nts=1 U A.U2042 7 bulge: nts=5; [1,0]; linked by [#-21,#-22] summary: [2] 1 0 [A.2033 A.2041 A.2035 A.2040] 1 1 nts=5 AAUGU A.A2033,A.A2034,A.U2035,A.G2040,A.U2041 nts=1 A A.A2034 nts=0 8 bulge: nts=5; [1,0]; linked by [#25,#26] summary: [2] 1 0 [A.2145 A.2255 A.2147 A.2254] 3 3 nts=5 GAGCC A.G2145,A.A2146,A.G2147,A.C2254,A.C2255 nts=1 A A.A2146 nts=0 9 bulge: nts=5; [0,1]; linked by [#39,#-31] summary: [2] 0 1 [A.2465 A.2662 A.2466 A.2660] 5 1 nts=5 UAUUA A.U2465,A.A2466,A.U2660,A.U2661,A.A2662 nts=0 nts=1 U A.U2661 10 bulge: nts=5; [0,1]; linked by [#41,#42] summary: [2] 0 1 [A.2490 A.2645 A.2491 A.2643] 4 2 nts=5 CCGAG A.C2490,A.C2491,A.G2643,A.A2644,A.G2645 nts=0 nts=1 A A.A2644 11 bulge: nts=5; [1,0]; linked by [#55,#56] summary: [2] 1 0 [A.2730 A.2930 A.2732 A.2929] 4 2 nts=5 AUGCU A.A2730,A.U2731,A.G2732,A.C2929,A.U2930 nts=1 U A.U2731 nts=0 12 bulge: nts=5; [1,0]; linked by [#58,#59] summary: [2] 1 0 [A.2744 A.2803 A.2746 A.2802] 5 2 nts=5 UAUAA A.U2744,A.A2745,A.U2746,A.A2802,A.A2803 nts=1 A A.A2745 nts=0 13 bulge: nts=5; [0,1]; linked by [#59,#-37] summary: [2] 0 1 [A.2747 A.2801 A.2748 A.2799] 2 1 nts=5 UAUUA A.U2747,A.A2748,A.U2799,A.U2800,A.A2801 nts=0 nts=1 U A.U2800 14 bulge: nts=5; [1,0]; linked by [#-37,#60] summary: [2] 1 0 [A.2748 A.2799 A.2750 A.2798] 1 4 nts=5 AAUAU A.A2748,A.A2749,A.U2750,A.A2798,A.U2799 nts=1 A A.A2749 nts=0 15 bulge: nts=5; [0,1]; linked by [#-41,#67] summary: [2] 0 1 [A.2941 A.2985 A.2942 A.2983] 1 2 nts=5 GCGAC A.G2941,A.C2942,A.G2983,A.A2984,A.C2985 nts=0 nts=1 A A.A2984 16 bulge: nts=5; [1,0]; linked by [#-43,#69] summary: [2] 1 0 [A.2955 A.2968 A.2957 A.2967] 1 2 nts=5 UAGCA A.U2955,A.A2956,A.G2957,A.C2967,A.A2968 nts=1 A A.A2956 nts=0 17 bulge: nts=5; [0,1]; linked by [#-44,#70] summary: [2] 0 1 [A.2994 A.3069 A.2995 A.3067] 1 3 nts=5 UGUGA A.U2994,A.G2995,A.U3067,A.G3068,A.A3069 nts=0 nts=1 G A.G3068 18 bulge: nts=5; [0,1]; linked by [#75,#76] summary: [2] 0 1 [A.3078 A.3090 A.3079 A.3088] 4 3 nts=5 CGCAG A.C3078,A.G3079,A.C3088,A.A3089,A.G3090 nts=0 nts=1 A A.A3089 19 bulge: nts=6; [2,0]; linked by [#-27,#28] summary: [2] 2 0 [A.2197 A.2212 A.2200 A.2211] 1 3 nts=6 GAAAUC A.G2197,A.A2198,A.A2199,A.A2200,A.U2211,A.C2212 nts=2 AA A.A2198,A.A2199 nts=0 20 bulge: nts=6; [2,0]; linked by [#40,#-32] summary: [2] 2 0 [A.2470 A.2657 A.2473 A.2656] 2 1 nts=6 GGAAUC A.G2470,A.G2471,A.A2472,A.A2473,A.U2656,A.C2657 nts=2 GA A.G2471,A.A2472 nts=0 21 bulge: nts=6; [2,0]; linked by [#46,#47] summary: [2] 2 0 [A.2548 A.2567 A.2551 A.2566] 3 2 nts=6 CCAGCG A.C2548,A.C2549,A.A2550,A.G2551,A.C2566,A.G2567 nts=2 CA A.C2549,A.A2550 nts=0 22 bulge: nts=6; [0,2]; linked by [#47,#48] summary: [2] 0 2 [A.2552 A.2565 A.2553 A.2562] 2 4 nts=6 UGUUAA A.U2552,A.G2553,A.U2562,A.U2563,A.A2564,A.A2565 nts=0 nts=2 UA A.U2563,A.A2564 23 bulge: nts=6; [0,2]; linked by [#-34,#-35] summary: [2] 0 2 [A.2596 A.2630 A.2597 A.2627] 1 1 nts=6 GCGUAU A.G2596,A.C2597,A.G2627,A.U2628,A.A2629,A.U2630 nts=0 nts=2 UA A.U2628,A.A2629 24 bulge: nts=6; [0,2]; linked by [#56,#57] summary: [2] 0 2 [A.2733 A.2928 A.2734 A.2925] 2 4 nts=6 GAUACC A.G2733,A.A2734,A.U2925,A.A2926,A.C2927,A.C2928 nts=0 nts=2 AC A.A2926,A.C2927 25 bulge: nts=6; [0,2]; linked by [#-45,#71] summary: [2] 0 2 [A.2999 A.3061 A.3000 A.3058] 1 5 nts=6 CAUACG A.C2999,A.A3000,A.U3058,A.A3059,A.C3060,A.G3061 nts=0 nts=2 AC A.A3059,A.C3060 **************************************************************************** List of 37 internal loops 1 symmetric internal loop: nts=6; [1,1]; linked by [#-8,#-9] summary: [2] 1 1 [A.1845 A.1858 A.1847 A.1856] 1 1 nts=6 CCUAUG A.C1845,A.C1846,A.U1847,A.A1856,A.U1857,A.G1858 nts=1 C A.C1846 nts=1 U A.U1857 2 symmetric internal loop: nts=6; [1,1]; linked by [#10,#-14] summary: [2] 1 1 [A.1904 A.2018 A.1906 A.2016] 2 1 nts=6 CCGCUG A.C1904,A.C1905,A.G1906,A.C2016,A.U2017,A.G2018 nts=1 C A.C1905 nts=1 U A.U2017 3 symmetric internal loop: nts=6; [1,1]; linked by [#11,#-15] summary: [2] 1 1 [A.1913 A.2006 A.1915 A.2004] 4 1 nts=6 GACGCC A.G1913,A.A1914,A.C1915,A.G2004,A.C2005,A.C2006 nts=1 A A.A1914 nts=1 C A.C2005 4 symmetric internal loop: nts=6; [1,1]; linked by [#12,#13] summary: [2] 1 1 [A.1925 A.1979 A.1927 A.1977] 5 3 nts=6 AAGUAU A.A1925,A.A1926,A.G1927,A.U1977,A.A1978,A.U1979 nts=1 A A.A1926 nts=1 A A.A1978 5 symmetric internal loop: nts=6; [1,1]; linked by [#-23,#24] summary: [2] 1 1 [A.2125 A.2140 A.2127 A.2138] 1 3 nts=6 CUAUUG A.C2125,A.U2126,A.A2127,A.U2138,A.U2139,A.G2140 nts=1 U A.U2126 nts=1 U A.U2139 6 symmetric internal loop: nts=6; [1,1]; linked by [#-25,#-26] summary: [2] 1 1 [A.2168 A.2192 A.2170 A.2190] 1 1 nts=6 UAGCAA A.U2168,A.A2169,A.G2170,A.C2190,A.A2191,A.A2192 nts=1 A A.A2169 nts=1 A A.A2191 7 symmetric internal loop: nts=6; [1,1]; linked by [#77,#78] summary: [2] 1 1 [A.3115 A.3141 A.3117 A.3139] 3 3 nts=6 UCCGAA A.U3115,A.C3116,A.C3117,A.G3139,A.A3140,A.A3141 nts=1 C A.C3116 nts=1 A A.A3140 8 symmetric internal loop: nts=6; [1,1]; linked by [#85,#86] summary: [2] 1 1 [B.1627 B.1641 B.1629 B.1639] 2 2 nts=6 CCAUAG B.C1627,B.C1628,B.A1629,B.U1639,B.A1640,B.G1641 nts=1 C B.C1628 nts=1 A B.A1640 9 asymmetric internal loop: nts=7; [2,1]; linked by [#-13,#8] summary: [2] 2 1 [A.1876 A.1897 A.1879 A.1895] 1 2 nts=7 UUUGCUA A.U1876,A.U1877,A.U1878,A.G1879,A.C1895,A.U1896,A.A1897 nts=2 UU A.U1877,A.U1878 nts=1 U A.U1896 10 asymmetric internal loop: nts=7; [2,1]; linked by [#15,#16] summary: [2] 2 1 [A.1948 A.1968 A.1951 A.1966] 3 4 nts=7 CGUCGUG A.C1948,A.G1949,A.U1950,A.C1951,A.G1966,A.U1967,A.G1968 nts=2 GU A.G1949,A.U1950 nts=1 U A.U1967 11 asymmetric internal loop: nts=7; [1,2]; linked by [#19,#20] summary: [2] 1 2 [A.2046 A.2094 A.2048 A.2091] 2 7 nts=7 CUUACUG A.C2046,A.U2047,A.U2048,A.A2091,A.C2092,A.U2093,A.G2094 nts=1 U A.U2047 nts=2 CU A.C2092,A.U2093 12 asymmetric internal loop: nts=7; [2,1]; linked by [#-31,#40] summary: [2] 2 1 [A.2466 A.2660 A.2469 A.2658] 1 2 nts=7 AAAAUCU A.A2466,A.A2467,A.A2468,A.A2469,A.U2658,A.C2659,A.U2660 nts=2 AA A.A2467,A.A2468 nts=1 C A.C2659 13 asymmetric internal loop: nts=7; [2,1]; linked by [#52,#53] summary: [2] 2 1 [A.2712 A.3106 A.2715 A.3104] 2 3 nts=7 GCAAUAC A.G2712,A.C2713,A.A2714,A.A2715,A.U3104,A.A3105,A.C3106 nts=2 CA A.C2713,A.A2714 nts=1 A A.A3105 14 asymmetric internal loop: nts=7; [1,2]; linked by [#53,#54] summary: [2] 1 2 [A.2717 A.3102 A.2719 A.3099] 3 2 nts=7 ACGCUAU A.A2717,A.C2718,A.G2719,A.C3099,A.U3100,A.A3101,A.U3102 nts=1 C A.C2718 nts=2 UA A.U3100,A.A3101 15 asymmetric internal loop: nts=7; [2,1]; linked by [#67,#-42] summary: [2] 2 1 [A.2943 A.2982 A.2946 A.2980] 2 1 nts=7 GCAAUAC A.G2943,A.C2944,A.A2945,A.A2946,A.U2980,A.A2981,A.C2982 nts=2 CA A.C2944,A.A2945 nts=1 A A.A2981 16 asymmetric internal loop: nts=7; [1,2]; linked by [#68,#-43] summary: [2] 1 2 [A.2953 A.2971 A.2955 A.2968] 6 1 nts=7 UCUAACA A.U2953,A.C2954,A.U2955,A.A2968,A.A2969,A.C2970,A.A2971 nts=1 C A.C2954 nts=2 AC A.A2969,A.C2970 17 asymmetric internal loop: nts=8; [1,3]; linked by [#-19,#17] summary: [2] 1 3 [A.1985 A.2001 A.1987 A.1997] 1 2 nts=8 GAGCUACC A.G1985,A.A1986,A.G1987,A.C1997,A.U1998,A.A1999,A.C2000,A.C2001 nts=1 A A.A1986 nts=3 UAC A.U1998,A.A1999,A.C2000 18 symmetric internal loop: nts=8; [2,2]; linked by [#-26,#27] summary: [2] 2 2 [A.2170 A.2190 A.2173 A.2187] 1 3 nts=8 GUAGCACC A.G2170,A.U2171,A.A2172,A.G2173,A.C2187,A.A2188,A.C2189,A.C2190 nts=2 UA A.U2171,A.A2172 nts=2 AC A.A2188,A.C2189 19 asymmetric internal loop: nts=8; [1,3]; linked by [#-42,#68] summary: [2] 1 3 [A.2946 A.2980 A.2948 A.2976] 1 6 nts=8 AUCGGUUU A.A2946,A.U2947,A.C2948,A.G2976,A.G2977,A.U2978,A.U2979,A.U2980 nts=1 U A.U2947 nts=3 GUU A.G2977,A.U2978,A.U2979 20 asymmetric internal loop: nts=8; [1,3]; linked by [#70,#-45] summary: [2] 1 3 [A.2997 A.3065 A.2999 A.3061] 3 1 nts=8 AUCGUGAU A.A2997,A.U2998,A.C2999,A.G3061,A.U3062,A.G3063,A.A3064,A.U3065 nts=1 U A.U2998 nts=3 UGA A.U3062,A.G3063,A.A3064 21 asymmetric internal loop: nts=8; [1,3]; linked by [#72,#73] summary: [2] 1 3 [A.3008 A.3031 A.3010 A.3027] 2 6 nts=8 CCGUAAAG A.C3008,A.C3009,A.G3010,A.U3027,A.A3028,A.A3029,A.A3030,A.G3031 nts=1 C A.C3009 nts=3 AAA A.A3028,A.A3029,A.A3030 22 asymmetric internal loop: nts=8; [3,1]; linked by [#79,#80] summary: [2] 3 1 [A.3148 A.3163 A.3152 A.3161] 5 3 nts=8 CCUACGCG A.C3148,A.C3149,A.U3150,A.A3151,A.C3152,A.G3161,A.C3162,A.G3163 nts=3 CUA A.C3149,A.U3150,A.A3151 nts=1 C A.C3162 23 asymmetric internal loop: nts=9; [2,3]; linked by [#8,#9] summary: [2] 2 3 [A.1880 A.1894 A.1883 A.1890] 2 2 nts=9 CAAGCAAAG A.C1880,A.A1881,A.A1882,A.G1883,A.C1890,A.A1891,A.A1892,A.A1893,A.G1894 nts=2 AA A.A1881,A.A1882 nts=3 AAA A.A1891,A.A1892,A.A1893 24 asymmetric internal loop: nts=9; [4,1]; linked by [#38,#39] summary: [2] 4 1 [A.2456 A.2668 A.2461 A.2666] 4 5 nts=9 UAAAAAUUA A.U2456,A.A2457,A.A2458,A.A2459,A.A2460,A.A2461,A.U2666,A.U2667,A.A2668 nts=4 AAAA A.A2457,A.A2458,A.A2459,A.A2460 nts=1 U A.U2667 25 symmetric internal loop: nts=10; [3,3]; linked by [#26,#-24] summary: [2] 3 3 [A.2149 A.2252 A.2153 A.2248] 3 1 nts=10 GUAAAUGAAC A.G2149,A.U2150,A.A2151,A.A2152,A.A2153,A.U2248,A.G2249,A.A2250,A.A2251,A.C2252 nts=3 UAA A.U2150,A.A2151,A.A2152 nts=3 GAA A.G2249,A.A2250,A.A2251 26 asymmetric internal loop: nts=10; [4,2]; linked by [#-32,#-33] summary: [2] 4 2 [A.2473 A.2656 A.2478 A.2653] 1 1 nts=10 ACUCGGCUGU A.A2473,A.C2474,A.U2475,A.C2476,A.G2477,A.G2478,A.C2653,A.U2654,A.G2655,A.U2656 nts=4 CUCG A.C2474,A.U2475,A.C2476,A.G2477 nts=2 UG A.U2654,A.G2655 27 symmetric internal loop: nts=10; [3,3]; linked by [#64,#65] summary: [2] 3 3 [A.2856 A.2876 A.2860 A.2872] 2 3 nts=10 CUAAGCAAAG A.C2856,A.U2857,A.A2858,A.A2859,A.G2860,A.C2872,A.A2873,A.A2874,A.A2875,A.G2876 nts=3 UAA A.U2857,A.A2858,A.A2859 nts=3 AAA A.A2873,A.A2874,A.A2875 28 asymmetric internal loop: nts=13; [5,4]; linked by [#-4,#4] summary: [2] 5 4 [A.1739 A.1758 A.1745 A.1753] 1 2 nts=13 AAAGUAUAGAAAU A.A1739,A.A1740,A.A1741,A.G1742,A.U1743,A.A1744,A.U1745,A.A1753,A.G1754,A.A1755,A.A1756,A.A1757,A.U1758 nts=5 AAGUA A.A1740,A.A1741,A.G1742,A.U1743,A.A1744 nts=4 GAAA A.G1754,A.A1755,A.A1756,A.A1757 29 asymmetric internal loop: nts=13; [3,6]; linked by [#-14,#11] summary: [2] 3 6 [A.1906 A.2016 A.1910 A.2009] 1 4 nts=13 GAAACGUGAUAGC A.G1906,A.A1907,A.A1908,A.A1909,A.C1910,A.G2009,A.U2010,A.G2011,A.A2012,A.U2013,A.A2014,A.G2015,A.C2016 nts=3 AAA A.A1907,A.A1908,A.A1909 nts=6 UGAUAG A.U2010,A.G2011,A.A2012,A.U2013,A.A2014,A.G2015 30 asymmetric internal loop: nts=13; [3,6]; linked by [#32,#33] summary: [2] 3 6 [A.2329 A.2448 A.2333 A.2441] 3 4 nts=13 CUCCGCUCAUAAG A.C2329,A.U2330,A.C2331,A.C2332,A.G2333,A.C2441,A.U2442,A.C2443,A.A2444,A.U2445,A.A2446,A.A2447,A.G2448 nts=3 UCC A.U2330,A.C2331,A.C2332 nts=6 UCAUAA A.U2442,A.C2443,A.A2444,A.U2445,A.A2446,A.A2447 31 symmetric internal loop: nts=14; [5,5]; linked by [#21,#22] summary: [2] 5 5 [A.2057 A.2082 A.2063 A.2076] 3 2 nts=14 CCCACAGCCCCUUG A.C2057,A.C2058,A.C2059,A.A2060,A.C2061,A.A2062,A.G2063,A.C2076,A.C2077,A.C2078,A.C2079,A.U2080,A.U2081,A.G2082 nts=5 CCACA A.C2058,A.C2059,A.A2060,A.C2061,A.A2062 nts=5 CCCUU A.C2077,A.C2078,A.C2079,A.U2080,A.U2081 32 asymmetric internal loop: nts=14; [3,7]; linked by [#35,#36] summary: [2] 3 7 [A.2377 A.2419 A.2381 A.2411] 3 4 nts=14 GCCCAUACCCUCAC A.G2377,A.C2378,A.C2379,A.C2380,A.A2381,A.U2411,A.A2412,A.C2413,A.C2414,A.C2415,A.U2416,A.C2417,A.A2418,A.C2419 nts=3 CCC A.C2378,A.C2379,A.C2380 nts=7 ACCCUCA A.A2412,A.C2413,A.C2414,A.C2415,A.U2416,A.C2417,A.A2418 33 asymmetric internal loop: nts=15; [6,5]; linked by [#-28,#30] summary: [2] 6 5 [A.2306 A.2680 A.2313 A.2674] 1 2 nts=15 AUAAGUAAUGAAAUU A.A2306,A.U2307,A.A2308,A.A2309,A.G2310,A.U2311,A.A2312,A.A2313,A.U2674,A.G2675,A.A2676,A.A2677,A.A2678,A.U2679,A.U2680 nts=6 UAAGUA A.U2307,A.A2308,A.A2309,A.G2310,A.U2311,A.A2312 nts=5 GAAAU A.G2675,A.A2676,A.A2677,A.A2678,A.U2679 34 asymmetric internal loop: nts=15; [6,5]; linked by [#78,#-46] summary: [2] 6 5 [A.3119 A.3137 A.3126 A.3131] 3 1 nts=15 CCCUGUACGGACAAG A.C3119,A.C3120,A.C3121,A.U3122,A.G3123,A.U3124,A.A3125,A.C3126,A.G3131,A.G3132,A.A3133,A.C3134,A.A3135,A.A3136,A.G3137 nts=6 CCUGUA A.C3120,A.C3121,A.U3122,A.G3123,A.U3124,A.A3125 nts=5 GACAA A.G3132,A.A3133,A.C3134,A.A3135,A.A3136 35 asymmetric internal loop: nts=16; [8,4]; linked by [#-33,#41] summary: [2] 8 4 [A.2478 A.2653 A.2487 A.2648] 1 4 nts=16 GCAAAUCUUAUUCAGC A.G2478,A.C2479,A.A2480,A.A2481,A.A2482,A.U2483,A.C2484,A.U2485,A.U2486,A.A2487,A.U2648,A.U2649,A.C2650,A.A2651,A.G2652,A.C2653 nts=8 CAAAUCUU A.C2479,A.A2480,A.A2481,A.A2482,A.U2483,A.C2484,A.U2485,A.U2486 nts=4 UCAG A.U2649,A.C2650,A.A2651,A.G2652 36 asymmetric internal loop: nts=16; [10,2]; linked by [#-35,#50] summary: [2] 10 2 [A.2597 A.2627 A.2608 A.2624] 1 5 nts=16 CAUAAUCACUUGCCUG A.C2597,A.A2598,A.U2599,A.A2600,A.A2601,A.U2602,A.C2603,A.A2604,A.C2605,A.U2606,A.U2607,A.G2608,A.C2624,A.C2625,A.U2626,A.G2627 nts=10 AUAAUCACUU A.A2598,A.U2599,A.A2600,A.A2601,A.U2602,A.C2603,A.A2604,A.C2605,A.U2606,A.U2607 nts=2 CU A.C2625,A.U2626 37 asymmetric internal loop: nts=23; [15,4]; linked by [#36,#-30] summary: [2] 15 4 [A.2384 A.2408 A.2400 A.2403] 4 1 nts=23 AUCUACAAUCAACCAACGUCAUU A.A2384,A.U2385,A.C2386,A.U2387,A.A2388,A.C2389,A.A2390,A.A2391,A.U2392,A.C2393,A.A2394,A.A2395,A.C2396,A.C2397,A.A2398,A.A2399,A.C2400,A.G2403,A.U2404,A.C2405,A.A2406,A.U2407,A.U2408 nts=15 UCUACAAUCAACCAA A.U2385,A.C2386,A.U2387,A.A2388,A.C2389,A.A2390,A.A2391,A.U2392,A.C2393,A.A2394,A.A2395,A.C2396,A.C2397,A.A2398,A.A2399 nts=4 UCAU A.U2404,A.C2405,A.A2406,A.U2407 **************************************************************************** List of 14 junctions 1 3-way junction: nts=12; [1,3,2]; linked by [#-16,#14,#15] summary: [3] 1 3 2 [A.1930 A.1973 A.1932 A.1942 A.1946 A.1970] 1 3 3 nts=12 CAGCACACGAAG A.C1930,A.A1931,A.G1932,A.C1942,A.A1943,A.C1944,A.A1945,A.C1946,A.G1970,A.A1971,A.A1972,A.G1973 nts=1 A A.A1931 nts=3 ACA A.A1943,A.C1944,A.A1945 nts=2 AA A.A1971,A.A1972 2 3-way junction: nts=14; [5,1,2]; linked by [#-15,#12,#-19] summary: [3] 5 1 2 [A.1915 A.2004 A.1921 A.1983 A.1985 A.2001] 1 5 1 nts=14 CGAGCUAUAGCGAG A.C1915,A.G1916,A.A1917,A.G1918,A.C1919,A.U1920,A.A1921,A.U1983,A.A1984,A.G1985,A.C2001,A.G2002,A.A2003,A.G2004 nts=5 GAGCU A.G1916,A.A1917,A.G1918,A.C1919,A.U1920 nts=1 A A.A1984 nts=2 GA A.G2002,A.A2003 3 3-way junction: nts=14; [1,6,1]; linked by [#-29,#34,#35] summary: [3] 1 6 1 [A.2343 A.2423 A.2345 A.2368 A.2375 A.2421] 1 5 3 nts=14 GCGCAAUUAACGUC A.G2343,A.C2344,A.G2345,A.C2368,A.A2369,A.A2370,A.U2371,A.U2372,A.A2373,A.A2374,A.C2375,A.G2421,A.U2422,A.C2423 nts=1 C A.C2344 nts=6 AAUUAA A.A2369,A.A2370,A.U2371,A.U2372,A.A2373,A.A2374 nts=1 U A.U2422 4 3-way junction: nts=14; [2,1,5]; linked by [#71,#72,#74] summary: [3] 2 1 5 [A.3004 A.3054 A.3007 A.3032 A.3034 A.3048] 5 2 5 nts=14 CAUCGUUAUUAAAG A.C3004,A.A3005,A.U3006,A.C3007,A.G3032,A.U3033,A.U3034,A.A3048,A.U3049,A.U3050,A.A3051,A.A3052,A.A3053,A.G3054 nts=2 AU A.A3005,A.U3006 nts=1 U A.U3033 nts=5 UUAAA A.U3049,A.U3050,A.A3051,A.A3052,A.A3053 5 3-way junction: nts=16; [6,3,1]; linked by [#33,#-29,#37] summary: [3] 6 3 1 [A.2336 A.2438 A.2343 A.2423 A.2427 A.2436] 4 1 2 nts=16 UAAGCCUGCAACCGCA A.U2336,A.A2337,A.A2338,A.G2339,A.C2340,A.C2341,A.U2342,A.G2343,A.C2423,A.A2424,A.A2425,A.C2426,A.C2427,A.G2436,A.C2437,A.A2438 nts=6 AAGCCU A.A2337,A.A2338,A.G2339,A.C2340,A.C2341,A.U2342 nts=3 AAC A.A2424,A.A2425,A.C2426 nts=1 C A.C2437 6 3-way junction: nts=21; [1,9,5]; linked by [#-39,#63,#66] summary: [3] 1 9 5 [A.2846 A.2915 A.2848 A.2890 A.2900 A.2909] 1 2 3 nts=21 GCAUCAAUUGAUCCGACCAAC A.G2846,A.C2847,A.A2848,A.U2890,A.C2891,A.A2892,A.A2893,A.U2894,A.U2895,A.G2896,A.A2897,A.U2898,A.C2899,A.C2900,A.G2909,A.A2910,A.C2911,A.C2912,A.A2913,A.A2914,A.C2915 nts=1 C A.C2847 nts=9 CAAUUGAUC A.C2891,A.A2892,A.A2893,A.U2894,A.U2895,A.G2896,A.A2897,A.U2898,A.C2899 nts=5 ACCAA A.A2910,A.C2911,A.C2912,A.A2913,A.A2914 7 3-way junction: nts=24; [5,5,8]; linked by [#1,#-1,#-5] summary: [3] 5 5 8 [A.1672 A.1816 A.1678 A.1797 A.1803 A.1807] 2 1 1 nts=24 CUAAACCGAUGAAAUAUAACCAAG A.C1672,A.U1673,A.A1674,A.A1675,A.A1676,A.C1677,A.C1678,A.G1797,A.A1798,A.U1799,A.G1800,A.A1801,A.A1802,A.A1803,A.U1807,A.A1808,A.U1809,A.A1810,A.A1811,A.C1812,A.C1813,A.A1814,A.A1815,A.G1816 nts=5 UAAAC A.U1673,A.A1674,A.A1675,A.A1676,A.C1677 nts=5 AUGAA A.A1798,A.U1799,A.G1800,A.A1801,A.A1802 nts=8 AUAACCAA A.A1808,A.U1809,A.A1810,A.A1811,A.C1812,A.C1813,A.A1814,A.A1815 8 3-way junction: nts=25; [2,13,4]; linked by [#-1,#2,#5] summary: [3] 2 13 4 [A.1678 A.1797 A.1681 A.1771 A.1785 A.1792] 1 2 2 nts=25 CUAGCAAUAGAUAUAGUACGGAAAG A.C1678,A.U1679,A.A1680,A.G1681,A.C1771,A.A1772,A.A1773,A.U1774,A.A1775,A.G1776,A.A1777,A.U1778,A.A1779,A.U1780,A.A1781,A.G1782,A.U1783,A.A1784,A.C1785,A.G1792,A.G1793,A.A1794,A.A1795,A.A1796,A.G1797 nts=2 UA A.U1679,A.A1680 nts=13 AAUAGAUAUAGUA A.A1772,A.A1773,A.U1774,A.A1775,A.G1776,A.A1777,A.U1778,A.A1779,A.U1780,A.A1781,A.G1782,A.U1783,A.A1784 nts=4 GAAA A.G1793,A.A1794,A.A1795,A.A1796 9 4-way junction: nts=13; [2,0,2,1]; linked by [#30,#31,#32,#38] summary: [4] 2 0 2 1 [A.2314 A.2673 A.2317 A.2326 A.2327 A.2450 A.2453 A.2671] 2 3 3 4 nts=13 CAUGCUAAAGCAG A.C2314,A.A2315,A.U2316,A.G2317,A.C2326,A.U2327,A.A2450,A.A2451,A.A2452,A.G2453,A.C2671,A.A2672,A.G2673 nts=2 AU A.A2315,A.U2316 nts=0 nts=2 AA A.A2451,A.A2452 nts=1 A A.A2672 10 4-way junction: nts=21; [1,0,8,4]; linked by [#45,#46,#49,#-34] summary: [4] 1 0 8 4 [A.2544 A.2635 A.2546 A.2569 A.2570 A.2587 A.2596 A.2630] 3 3 5 1 nts=21 CUGCCGCAAAGGUAGUGAAUG A.C2544,A.U2545,A.G2546,A.C2569,A.C2570,A.G2587,A.C2588,A.A2589,A.A2590,A.A2591,A.G2592,A.G2593,A.U2594,A.A2595,A.G2596,A.U2630,A.G2631,A.A2632,A.A2633,A.U2634,A.G2635 nts=1 U A.U2545 nts=0 nts=8 CAAAGGUA A.C2588,A.A2589,A.A2590,A.A2591,A.G2592,A.G2593,A.U2594,A.A2595 nts=4 GAAU A.G2631,A.A2632,A.A2633,A.U2634 11 4-way junction: nts=23; [3,4,4,4]; linked by [#42,#43,#44,#45] summary: [4] 3 4 4 4 [A.2492 A.2642 A.2496 A.2508 A.2513 A.2537 A.2542 A.2637] 2 2 6 3 nts=23 GCCUGCAUCACGCACCGCUCCAC A.G2492,A.C2493,A.C2494,A.U2495,A.G2496,A.C2508,A.A2509,A.U2510,A.C2511,A.A2512,A.C2513,A.G2537,A.C2538,A.A2539,A.C2540,A.C2541,A.G2542,A.C2637,A.U2638,A.C2639,A.C2640,A.A2641,A.C2642 nts=3 CCU A.C2493,A.C2494,A.U2495 nts=4 AUCA A.A2509,A.U2510,A.C2511,A.A2512 nts=4 CACC A.C2538,A.A2539,A.C2540,A.C2541 nts=4 UCCA A.U2638,A.C2639,A.C2640,A.A2641 12 5-way junction: nts=36; [9,3,2,3,9]; linked by [#-11,#-12,#10,#18,#29] summary: [5] 9 3 2 3 9 [A.1865 A.2300 A.1875 A.1899 A.1903 A.2019 A.2022 A.2271 A.2275 A.2290] 1 1 2 6 5 nts=36 CUAGAAAUAACGACCCGUUGCCAAUAAGAACUAAUG A.C1865,A.U1866,A.A1867,A.G1868,A.A1869,A.A1870,A.A1871,A.U1872,A.A1873,A.A1874,A.C1875,A.G1899,A.A1900,A.C1901,A.C1902,A.C1903,A.G2019,A.U2020,A.U2021,A.G2022,A.C2271,A.C2272,A.A2273,A.A2274,A.U2275,A.A2290,A.A2291,A.G2292,A.A2293,A.A2294,A.C2295,A.U2296,A.A2297,A.A2298,A.U2299,A.G2300 nts=9 UAGAAAUAA A.U1866,A.A1867,A.G1868,A.A1869,A.A1870,A.A1871,A.U1872,A.A1873,A.A1874 nts=3 ACC A.A1900,A.C1901,A.C1902 nts=2 UU A.U2020,A.U2021 nts=3 CAA A.C2272,A.A2273,A.A2274 nts=9 AGAACUAAU A.A2291,A.G2292,A.A2293,A.A2294,A.C2295,A.U2296,A.A2297,A.A2298,A.U2299 13 5-way junction: nts=40; [6,7,8,5,4]; linked by [#54,#55,#-41,#-44,#75] summary: [5] 6 7 8 5 4 [A.2720 A.3098 A.2727 A.2933 A.2941 A.2985 A.2994 A.3069 A.3075 A.3093] 2 4 1 1 4 nts=40 AGAAGACCGGAUAACAGCCUCGAUGUUAGUUCAGCGGUUU A.A2720,A.G2721,A.A2722,A.A2723,A.G2724,A.A2725,A.C2726,A.C2727,A.G2933,A.G2934,A.A2935,A.U2936,A.A2937,A.A2938,A.C2939,A.A2940,A.G2941,A.C2985,A.C2986,A.U2987,A.C2988,A.G2989,A.A2990,A.U2991,A.G2992,A.U2993,A.U2994,A.A3069,A.G3070,A.U3071,A.U3072,A.C3073,A.A3074,A.G3075,A.C3093,A.G3094,A.G3095,A.U3096,A.U3097,A.U3098 nts=6 GAAGAC A.G2721,A.A2722,A.A2723,A.G2724,A.A2725,A.C2726 nts=7 GAUAACA A.G2934,A.A2935,A.U2936,A.A2937,A.A2938,A.C2939,A.A2940 nts=8 CUCGAUGU A.C2986,A.U2987,A.C2988,A.G2989,A.A2990,A.U2991,A.G2992,A.U2993 nts=5 GUUCA A.G3070,A.U3071,A.U3072,A.C3073,A.A3074 nts=4 GGUU A.G3094,A.G3095,A.U3096,A.U3097 14 6-way junction: nts=30; [4,1,2,1,2,8]; linked by [#18,#-20,#19,#23,#-23,#25] summary: [6] 4 1 2 1 2 8 [A.2027 A.2266 A.2032 A.2043 A.2045 A.2095 A.2098 A.2123 A.2125 A.2140 A.2143 A.2257] 6 1 2 10 1 3 nts=30 AGAUAGCAAUUAGCACGUAGCACACCCAAU A.A2027,A.G2028,A.A2029,A.U2030,A.A2031,A.G2032,A.C2043,A.A2044,A.A2045,A.U2095,A.U2096,A.A2097,A.G2098,A.C2123,A.A2124,A.C2125,A.G2140,A.U2141,A.A2142,A.G2143,A.C2257,A.A2258,A.C2259,A.A2260,A.C2261,A.C2262,A.C2263,A.A2264,A.A2265,A.U2266 nts=4 GAUA A.G2028,A.A2029,A.U2030,A.A2031 nts=1 A A.A2044 nts=2 UA A.U2096,A.A2097 nts=1 A A.A2124 nts=2 UA A.U2141,A.A2142 nts=8 ACACCCAA A.A2258,A.C2259,A.A2260,A.C2261,A.C2262,A.C2263,A.A2264,A.A2265 **************************************************************************** List of 33 non-loop single-stranded segments 1 nts=36* CAAACCCACUCCACCUUACUACCAGCAACCUUAGCC A.C1685,A.A1686,A.A1687,A.A1688,A.C1689,A.C1690,A.C1691,A.A1692,A.C1693,A.U1694,A.C1695,A.C1696,A.A1697,A.C1698,A.C1699,A.U1700,A.U1701,A.A1702,A.C1703,A.U1704,A.A1705,A.C1706,A.C1707,A.A1708,A.G1709,A.C1711,A.A1712,A.A1713,A.C1714,A.C1715,A.U1716,A.U1717,A.A1718,A.G1719,A.C1720,A.C1721 2 nts=5* UACAU A.U1730,A.A1731,A.C1732,A.A1737,A.U1738 3 nts=3* UGU A.U1759,A.G1760,A.U1766 4 nts=9 AUAAUAUAG A.A1818,A.U1819,A.A1820,A.A1821,A.U1822,A.A1823,A.U1824,A.A1825,A.G1826 5 nts=1 A A.A1828 6 nts=1 A A.A1842 7 nts=1 A A.A1844 8 nts=1 A A.A1859 9 nts=2* AA A.A1935,A.A1938 10 nts=6* ACCAAA A.A2065,A.C2066,A.C2067,A.A2072,A.A2073,A.A2074 11 nts=14 AAAUUUAACACCCA A.A2154,A.A2155,A.A2156,A.U2157,A.U2158,A.U2159,A.A2160,A.A2161,A.C2162,A.A2163,A.C2164,A.C2165,A.C2166,A.A2167 12 nts=4 UUAA A.U2193,A.U2194,A.A2195,A.A2196 13 nts=26* AACACCAAAAAUCCCAAACAUAUAAC A.A2213,A.A2214,A.C2215,A.A2216,A.C2217,A.C2218,A.A2228,A.A2229,A.A2230,A.A2231,A.A2232,A.U2233,A.C2234,A.C2235,A.C2236,A.A2237,A.A2238,A.A2239,A.C2240,A.A2241,A.U2242,A.A2243,A.U2244,A.A2245,A.A2246,A.C2247 14 nts=6* AUCACA A.A2350,A.U2351,A.C2357,A.A2358,A.C2359,A.A2363 15 nts=4* UUAA A.U2575,A.U2580,A.A2581,A.A2582 16 nts=1 A A.A2682 17 nts=7 AUAACAC A.A2704,A.U2705,A.A2706,A.A2707,A.C2708,A.A2709,A.C2710 18 nts=2 UU A.U2738,A.U2739 19 nts=10* AACAGUAACC A.A2754,A.A2755,A.C2756,A.A2757,A.G2758,A.U2759,A.A2760,A.A2792,A.C2793,A.C2794 20 nts=2 UC A.U2808,A.C2809 21 nts=5 UACAU A.U2850,A.A2851,A.C2852,A.A2853,A.U2854 22 nts=4 GAAC A.G2878,A.A2879,A.A2880,A.C2881 23 nts=5 GAACA A.G2917,A.A2918,A.A2919,A.C2920,A.A2921 24 nts=2 UU A.U3108,A.U3109 25 nts=6 CCCCCG A.C3168,A.C3169,A.C3170,A.C3171,A.C3172,A.G3173 26 nts=9* GAUACCCAC A.G3196,A.A3201,A.U3202,A.A3203,A.C3204,A.C3205,A.C3206,A.A3207,A.C3212 27 nts=1 U A.U3228 28 nts=2 UA B.U1609,B.A1610 29 nts=4* UAAA B.U1614,B.A1615,B.A1616,B.A1621 30 nts=1 A B.A1625 31 nts=4 AGAU B.A1643,B.G1644,B.A1645,B.U1646 32 nts=1 A B.A1670 33 nts=1 A A.A3301 **************************************************************************** List of 2 kissing loop interactions 1 isolated-pair #-38 between hairpin loops #25 and #27 2 isolated-pair #-3 between hairpin loops #1 and #2 **************************************************************************** List of 61 A-minor motifs (types I, II, or X) 1 type=II A|C-G A.A1718|A.C1911,A.G2008 WC -A.C1911 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.79],N3-O2'(hydroxyl)[2.59]" +A.G2008 H-bonds[1]: "N1-N2(amino)[3.54]" 2 type=X A|A-G A.A1724|A.A2034,A.G2040 -- -A.A2034 H-bonds[0]: "" +A.G2040 H-bonds[3]: "N6(amino)-O2'(hydroxyl)[2.76],N6(amino)-N3[3.03],N1-N2(amino)[2.75]" 3 type=X A|U-G A.A1724|A.U2035,A.G2040 Wobble -A.U2035 H-bonds[0]: "" +A.G2040 H-bonds[3]: "N6(amino)-O2'(hydroxyl)[2.76],N6(amino)-N3[3.03],N1-N2(amino)[2.75]" 4 type=I A|A-U A.A1751|A.A1722,A.U1729 WC -A.A1722 H-bonds[1]: "O2'(hydroxyl)-O2'(hydroxyl)[3.26]" +A.U1729 H-bonds[1]: "N1-O2'(hydroxyl)[2.77]" 5 type=X A|G-C A.A1775|A.G1681,A.C1771 WC +A.G1681 H-bonds[0]: "" -A.C1771 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.75],N3-O2'(hydroxyl)[2.95]" 6 type=II A|C-G A.A1789|A.C1915,A.G2004 WC -A.C1915 H-bonds[1]: "N3-O2'(hydroxyl)[2.92]" +A.G2004 H-bonds[0]: "" 7 type=I A|A-C A.A1790|A.A1914,A.C2005 ~Wobble -A.A1914 H-bonds[0]: "" +A.C2005 H-bonds[1]: "N1-O2'(hydroxyl)[2.66]" 8 type=II A|U-A A.A1814|A.U1862,A.A2303 WC -A.U1862 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.68],N3-O2'(hydroxyl)[2.64]" +A.A2303 H-bonds[0]: "" 9 type=I A|U-G A.A1815|A.U1861,A.G2304 Wobble -A.U1861 H-bonds[1]: "O2'(hydroxyl)-O2'(hydroxyl)[3.25]" +A.G2304 H-bonds[2]: "N1-O2'(hydroxyl)[3.60],N3-N2(amino)[2.81]" 10 type=X A|C-G A.A1828|A.C2683,A.G2697 WC +A.C2683 H-bonds[3]: "N7-O2'(hydroxyl)[3.04],N6(amino)-O2'(hydroxyl)[2.95],N6(amino)-O2(carbonyl)[2.86]" -A.G2697 H-bonds[0]: "" 11 type=I A|C-G A.A1867|A.C1903,A.G2019 WC -A.C1903 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.85],O2'(hydroxyl)-O2(carbonyl)[2.55]" +A.G2019 H-bonds[2]: "N1-O2'(hydroxyl)[2.55],N3-N2(amino)[2.80]" 12 type=II A|A-U A.A1907|A.A2730,A.U2930 WC +A.A2730 H-bonds[0]: "" -A.U2930 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[3.04],N3-O2'(hydroxyl)[2.39]" 13 type=I A|G-C A.A1908|A.G2732,A.C2929 WC +A.G2732 H-bonds[2]: "N1-O2'(hydroxyl)[2.57],N3-N2(amino)[3.05]" -A.C2929 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.89],O2'(hydroxyl)-O2(carbonyl)[2.90]" 14 type=X A|G-C A.A1917|A.G1988,A.C1996 WC +A.G1988 H-bonds[3]: "N6(amino)-O2'(hydroxyl)[2.69],N6(amino)-N3[2.95],N1-N2(amino)[2.73]" -A.C1996 H-bonds[0]: "" 15 type=I A|G-C A.A1991|A.G2496,A.C2508 WC +A.G2496 H-bonds[2]: "N1-O2'(hydroxyl)[2.91],N3-N2(amino)[3.00]" -A.C2508 H-bonds[3]: "O3'-O2'(hydroxyl)[2.73],O2'(hydroxyl)-O2'(hydroxyl)[2.71],O2'(hydroxyl)-O2(carbonyl)[2.63]" 16 type=X A|G-U A.A1994|A.G2735,A.U2924 Wobble -A.G2735 H-bonds[1]: "N1-O2'(hydroxyl)[2.97]" +A.U2924 H-bonds[0]: "" 17 type=X A|C-G A.A2039|A.C2728,A.G2932 WC +A.C2728 H-bonds[0]: "" -A.G2932 H-bonds[2]: "N6(amino)-N3[3.17],N1-O2'(hydroxyl)[2.55]" 18 type=I A|G-C A.A2112|A.G2943,A.C2982 WC -A.G2943 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.93],N3-N2(amino)[3.14]" +A.C2982 H-bonds[1]: "N1-O2'(hydroxyl)[2.92]" 19 type=II A|C-G A.A2131|A.C2689,A.G2700 WC +A.C2689 H-bonds[0]: "" -A.G2700 H-bonds[3]: "O2'(hydroxyl)-O2'(hydroxyl)[3.11],N1-N2(amino)[3.51],N3-O2'(hydroxyl)[2.76]" 20 type=I A|G-C A.A2132|A.G2690,A.C2699 WC +A.G2690 H-bonds[2]: "N1-O2'(hydroxyl)[2.45],N3-N2(amino)[2.79]" -A.C2699 H-bonds[1]: "O3'-O2'(hydroxyl)[3.46]" 21 type=X A|G-C A.A2134|A.G2098,A.C2123 WC +A.G2098 H-bonds[0]: "" -A.C2123 H-bonds[1]: "N3-O2'(hydroxyl)[2.80]" 22 type=II A|A-U A.A2151|A.A2127,A.U2138 WC +A.A2127 H-bonds[0]: "" -A.U2138 H-bonds[3]: "O2'(hydroxyl)-O3'[3.10],O2'(hydroxyl)-O2'(hydroxyl)[2.67],N3-O2'(hydroxyl)[2.58]" 23 type=I A|G-C A.A2152|A.G2128,A.C2137 WC +A.G2128 H-bonds[2]: "N1-O2'(hydroxyl)[2.74],N3-N2(amino)[3.22]" -A.C2137 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[3.07],O2'(hydroxyl)-O2(carbonyl)[2.77]" 24 type=X A|A-U A.A2228|A.A2951,A.U2973 WC -A.A2951 H-bonds[1]: "N1-O2'(hydroxyl)[3.47]" +A.U2973 H-bonds[0]: "" 25 type=X A|U-A A.A2229|A.U2950,A.A2974 WC -A.U2950 H-bonds[0]: "" +A.A2974 H-bonds[1]: "N6(amino)-N3[3.22]" 26 type=X A|A-U A.A2229|A.A2951,A.U2973 WC -A.A2951 H-bonds[1]: "N6(amino)-N3[3.36]" +A.U2973 H-bonds[0]: "" 27 type=X A|C-G A.A2230|A.C2949,A.G2975 WC -A.C2949 H-bonds[0]: "" +A.G2975 H-bonds[1]: "N6(amino)-N3[3.11]" 28 type=X A|U-A A.A2230|A.U2950,A.A2974 WC -A.U2950 H-bonds[1]: "N6(amino)-O2(carbonyl)[2.98]" +A.A2974 H-bonds[0]: "" 29 type=X A|A-U A.A2231|A.A3003,A.U3055 WC -A.A3003 H-bonds[1]: "N3-O2'(hydroxyl)[2.52]" +A.U3055 H-bonds[0]: "" 30 type=I A|G-C A.A2232|A.G3002,A.C3056 WC -A.G3002 H-bonds[3]: "O3'-O2'(hydroxyl)[3.14],O2'(hydroxyl)-N3[2.64],N3-N2(amino)[2.65]" +A.C3056 H-bonds[1]: "N1-O2'(hydroxyl)[2.71]" 31 type=X A|A-U A.A2250|A.A2127,A.U2138 WC -A.A2127 H-bonds[1]: "O2'(hydroxyl)-O2'(hydroxyl)[2.96]" +A.U2138 H-bonds[0]: "" 32 type=X A|C-G A.A2265|A.C2046,A.G2094 WC +A.C2046 H-bonds[0]: "" -A.G2094 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[3.02],N3-O2'(hydroxyl)[2.69]" 33 type=I A|C-G A.A2297|A.C1845,A.G1858 WC +A.C1845 H-bonds[2]: "N6(amino)-O2'(hydroxyl)[3.28],N1-O2'(hydroxyl)[2.38]" -A.G1858 H-bonds[1]: "N3-N2(amino)[2.98]" 34 type=I A|C-G A.A2298|A.C1904,A.G2018 WC +A.C1904 H-bonds[0]: "" -A.G2018 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.86],N3-N2(amino)[3.07]" 35 type=X A|C-G A.A2451|A.C2328,A.G2449 WC -A.C2328 H-bonds[2]: "N6(amino)-O2(carbonyl)[2.86],N1-O2'(hydroxyl)[2.95]" +A.G2449 H-bonds[1]: "N6(amino)*N2(amino)[3.36]" 36 type=X A|G-C A.A2481|A.G2478,A.C2653 WC +A.G2478 H-bonds[2]: "N6(amino)-O2'(hydroxyl)[2.96],N1-N2(amino)[2.90]" -A.C2653 H-bonds[0]: "" 37 type=X A|G-C A.A2482|A.G2478,A.C2653 WC +A.G2478 H-bonds[1]: "N1-N2(amino)[3.49]" -A.C2653 H-bonds[1]: "N3-O2'(hydroxyl)[3.24]" 38 type=I A|G-C A.A2505|A.G3075,A.C3093 WC +A.G3075 H-bonds[1]: "N1-O2'(hydroxyl)[2.85]" -A.C3093 H-bonds[0]: "" 39 type=I A|C-G A.A2564|A.C2513,A.G2537 WC +A.C2513 H-bonds[1]: "N1-O2'(hydroxyl)[3.13]" -A.G2537 H-bonds[0]: "" 40 type=X A|C-G A.A2590|A.C2548,A.G2567 WC -A.C2548 H-bonds[1]: "N3-O2'(hydroxyl)[2.72]" +A.G2567 H-bonds[0]: "" 41 type=I A|C-G A.A2591|A.C2547,A.G2568 WC -A.C2547 H-bonds[1]: "O2'(hydroxyl)-O2'(hydroxyl)[3.17]" +A.G2568 H-bonds[2]: "N1-O2'(hydroxyl)[2.81],N3-N2(amino)[3.29]" 42 type=II A|C-G A.A2615|A.C3035,A.G3047 WC +A.C3035 H-bonds[0]: "" -A.G3047 H-bonds[1]: "N3-O2'(hydroxyl)[2.67]" 43 type=I A|G-C A.A2616|A.G3036,A.C3046 WC +A.G3036 H-bonds[2]: "N1-O2'(hydroxyl)[2.72],N3-N2(amino)[2.92]" -A.C3046 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[3.15],O2'(hydroxyl)-O2(carbonyl)[2.88]" 44 type=X A|U-A A.A2617|A.U2613,A.A2619 -- -A.U2613 H-bonds[0]: "" +A.A2619 H-bonds[1]: "O2'(hydroxyl)-N7[2.82]" 45 type=X A|G-C A.A2629|A.G3079,A.C3088 WC -A.G3079 H-bonds[1]: "N3-O2'(hydroxyl)[2.97]" +A.C3088 H-bonds[0]: "" 46 type=I A|C-G A.A2632|A.C2544,A.G2635 WC +A.C2544 H-bonds[1]: "N1-O2'(hydroxyl)[2.88]" -A.G2635 H-bonds[3]: "O2'(hydroxyl)-O2'(hydroxyl)[2.86],O2'(hydroxyl)-N3[2.55],N3-N2(amino)[2.85]" 47 type=X A|C-G A.A2633|A.C2513,A.G2537 WC +A.C2513 H-bonds[0]: "" -A.G2537 H-bonds[2]: "O3'-O2'(hydroxyl)[3.40],N3-N2(amino)[3.22]" 48 type=X A|C-G A.A2644|A.C1948,A.G1968 WC +A.C1948 H-bonds[0]: "" -A.G1968 H-bonds[2]: "N1-N2(amino)[3.16],N3-O2'(hydroxyl)[2.80]" 49 type=X A|C-G A.A2694|A.C2942,A.G2983 WC -A.C2942 H-bonds[1]: "N3-O2'(hydroxyl)[2.49]" +A.G2983 H-bonds[0]: "" 50 type=II A|G-C A.A2837|A.G2105,A.C2116 WC +A.G2105 H-bonds[1]: "N1-N2(amino)[2.88]" -A.C2116 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.93],N3-O2'(hydroxyl)[2.70]" 51 type=I A|A-U A.A2838|A.A2106,A.U2115 WC +A.A2106 H-bonds[1]: "N1-O2'(hydroxyl)[2.95]" -A.U2115 H-bonds[0]: "" 52 type=X A|G-C A.A2892|A.G2825,A.C2843 WC -A.G2825 H-bonds[2]: "N1-N2(amino)[3.20],N3-O2'(hydroxyl)[2.71]" +A.C2843 H-bonds[0]: "" 53 type=I A|C-G A.A2893|A.C2824,A.G2844 WC -A.C2824 H-bonds[1]: "O3'-O2'(hydroxyl)[3.54]" +A.G2844 H-bonds[2]: "N1-O2'(hydroxyl)[2.97],N3-N2(amino)[3.14]" 54 type=X A|U-A A.A2956|A.U2955,A.A2968 WC +A.U2955 H-bonds[1]: "OP2-O2'(hydroxyl)[3.14]" -A.A2968 H-bonds[2]: "N6(amino)-O2'(hydroxyl)[2.88],N6(amino)-N3[3.13]" 55 type=X A|C-C A.A2969|A.C2954,A.C2970 -- -A.C2954 H-bonds[1]: "N6(amino)-O2(carbonyl)[3.04]" +A.C2970 H-bonds[0]: "" 56 type=X A|U-A A.A2969|A.U2955,A.A2968 WC -A.U2955 H-bonds[0]: "" +A.A2968 H-bonds[1]: "O4'-O2'(hydroxyl)[3.17]" 57 type=II A|C-G A.A3018|A.C3126,A.G3131 WC -A.C3126 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.77],N3-O2'(hydroxyl)[3.27]" +A.G3131 H-bonds[0]: "" 58 type=X A|C-G A.A3051|A.C3008,A.G3031 WC -A.C3008 H-bonds[1]: "N3-O2'(hydroxyl)[2.58]" +A.G3031 H-bonds[0]: "" 59 type=I A|C-G A.A3052|A.C3007,A.G3032 WC -A.C3007 H-bonds[2]: "O3'-O2'(hydroxyl)[3.53],O2'(hydroxyl)-O2(carbonyl)[3.52]" +A.G3032 H-bonds[2]: "N1-O2'(hydroxyl)[2.64],N3-N2(amino)[2.95]" 60 type=I A|C-G A.A3085|A.C2736,A.G2923 WC -A.C2736 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.84],O2'(hydroxyl)-O2(carbonyl)[2.83]" +A.G2923 H-bonds[2]: "N1-O2'(hydroxyl)[2.80],N3-N2(amino)[2.96]" 61 type=X A|C-G A.A3151|A.C3148,A.G3163 WC -A.C3148 H-bonds[0]: "" +A.G3163 H-bonds[1]: "N6(amino)-N3[3.07]" **************************************************************************** List of 9 ribose zippers 1 nts=4 AGCC A.A1718,A.G1719,A.C1910,A.C1911 2 nts=4 AAUU A.A1814,A.A1815,A.U1861,A.U1862 3 nts=4 UAAA A.U1822,A.A1823,A.A2706,A.A2707 4 nts=4 AACU A.A1907,A.A1908,A.C2929,A.U2930 5 nts=4 CAGC A.C2111,A.A2112,A.G2943,A.C2944 6 nts=4 CUCA A.C2116,A.U2117,A.C2836,A.A2837 7 nts=4 CUAA A.C2137,A.U2138,A.A2151,A.A2152 8 nts=4 CAGG A.C2502,A.A2503,A.G3094,A.G3095 9 nts=4 AACG A.A2615,A.A2616,A.C3046,A.G3047 **************************************************************************** List of 279 splayed-apart dinucleotides 1 A.A1688 A.C1689 angle=92 distance=12.0 ratio=0.72 2 A.C1693 A.U1694 angle=147 distance=17.2 ratio=0.96 3 A.C1699 A.U1700 angle=86 distance=13.2 ratio=0.68 4 A.U1701 A.A1702 angle=142 distance=19.1 ratio=0.95 5 A.C1703 A.U1704 angle=93 distance=15.0 ratio=0.73 6 A.U1704 A.A1705 angle=127 distance=18.2 ratio=0.90 7 A.C1707 A.A1708 angle=86 distance=14.6 ratio=0.68 8 A.A1712 A.A1713 angle=86 distance=13.4 ratio=0.69 9 A.C1715 A.U1716 angle=96 distance=11.9 ratio=0.75 10 A.A1723 A.A1724 angle=125 distance=16.5 ratio=0.89 11 A.A1724 A.C1725 angle=118 distance=16.0 ratio=0.86 12 A.A1727 A.U1728 angle=95 distance=14.7 ratio=0.74 13 A.G1747 A.G1748 angle=90 distance=14.7 ratio=0.71 14 A.G1748 A.C1749 angle=134 distance=19.0 ratio=0.92 15 A.C1749 A.G1750 angle=95 distance=14.5 ratio=0.74 16 A.U1766 A.G1767 angle=86 distance=13.2 ratio=0.68 17 A.G1768 A.C1769 angle=158 distance=18.8 ratio=0.98 18 A.C1769 A.G1770 angle=153 distance=20.6 ratio=0.97 19 A.A1773 A.U1774 angle=160 distance=18.2 ratio=0.98 20 A.U1774 A.A1775 angle=117 distance=16.1 ratio=0.85 21 A.A1779 A.U1780 angle=151 distance=17.6 ratio=0.97 22 A.A1796 A.G1797 angle=86 distance=12.9 ratio=0.68 23 A.A1798 A.U1799 angle=153 distance=18.5 ratio=0.97 24 A.A1803 A.A1804 angle=130 distance=18.7 ratio=0.91 25 A.A1804 A.A1805 angle=170 distance=19.2 ratio=1.00 26 A.A1808 A.U1809 angle=98 distance=13.2 ratio=0.76 27 A.A1820 A.A1821 angle=136 distance=17.8 ratio=0.93 28 A.A1823 A.U1824 angle=112 distance=16.5 ratio=0.83 29 A.G1826 A.C1827 angle=118 distance=18.5 ratio=0.86 30 A.A1842 A.U1843 angle=102 distance=14.5 ratio=0.77 31 A.U1843 A.A1844 angle=97 distance=16.0 ratio=0.75 32 A.A1855 A.A1856 angle=141 distance=18.5 ratio=0.94 33 A.A1859 A.A1860 angle=139 distance=16.8 ratio=0.94 34 A.A1885 A.G1886 angle=123 distance=15.6 ratio=0.88 35 A.G1886 A.A1887 angle=110 distance=15.9 ratio=0.82 36 A.G1888 A.C1889 angle=94 distance=14.0 ratio=0.73 37 A.A1891 A.A1892 angle=93 distance=12.1 ratio=0.73 38 A.A1892 A.A1893 angle=115 distance=16.4 ratio=0.84 39 A.C1902 A.C1903 angle=169 distance=18.6 ratio=1.00 40 A.A1917 A.G1918 angle=116 distance=15.7 ratio=0.85 41 A.G1918 A.C1919 angle=86 distance=13.1 ratio=0.68 42 A.C1930 A.A1931 angle=133 distance=16.4 ratio=0.92 43 A.A1938 A.G1939 angle=132 distance=16.3 ratio=0.91 44 A.G1939 A.A1940 angle=147 distance=17.2 ratio=0.96 45 A.U1956 A.A1957 angle=154 distance=19.1 ratio=0.97 46 A.A1957 A.G1958 angle=93 distance=14.3 ratio=0.73 47 A.A1960 A.A1961 angle=128 distance=16.2 ratio=0.90 48 A.A1961 A.A1962 angle=111 distance=15.0 ratio=0.82 49 A.A1971 A.A1972 angle=130 distance=16.9 ratio=0.91 50 A.G1973 A.A1974 angle=139 distance=18.8 ratio=0.94 51 A.A1974 A.U1975 angle=164 distance=18.6 ratio=0.99 52 A.G1985 A.A1986 angle=162 distance=18.3 ratio=0.99 53 A.A1986 A.G1987 angle=129 distance=16.9 ratio=0.90 54 A.G1990 A.A1991 angle=153 distance=18.1 ratio=0.97 55 A.A1991 A.C1992 angle=163 distance=19.2 ratio=0.99 56 A.A1994 A.A1995 angle=94 distance=13.9 ratio=0.73 57 A.C1997 A.U1998 angle=143 distance=18.1 ratio=0.95 58 A.U1998 A.A1999 angle=94 distance=13.8 ratio=0.73 59 A.A1999 A.C2000 angle=101 distance=14.9 ratio=0.77 60 A.C2001 A.G2002 angle=126 distance=17.1 ratio=0.89 61 A.A2003 A.G2004 angle=118 distance=16.4 ratio=0.86 62 A.U2010 A.G2011 angle=110 distance=16.8 ratio=0.82 63 A.G2011 A.A2012 angle=151 distance=18.1 ratio=0.97 64 A.A2014 A.G2015 angle=127 distance=17.4 ratio=0.89 65 A.G2015 A.C2016 angle=110 distance=16.0 ratio=0.82 66 A.U2020 A.U2021 angle=108 distance=14.8 ratio=0.81 67 A.U2021 A.G2022 angle=87 distance=13.9 ratio=0.69 68 A.U2030 A.A2031 angle=163 distance=19.9 ratio=0.99 69 A.U2035 A.C2036 angle=133 distance=16.5 ratio=0.92 70 A.U2038 A.A2039 angle=170 distance=19.6 ratio=1.00 71 A.A2039 A.G2040 angle=123 distance=16.9 ratio=0.88 72 A.A2064 A.A2065 angle=107 distance=14.5 ratio=0.81 73 A.A2097 A.G2098 angle=125 distance=18.9 ratio=0.89 74 A.A2109 A.A2110 angle=128 distance=17.0 ratio=0.90 75 A.A2110 A.C2111 angle=161 distance=18.8 ratio=0.99 76 A.A2112 A.G2113 angle=118 distance=17.6 ratio=0.86 77 A.G2113 A.C2114 angle=158 distance=19.0 ratio=0.98 78 A.A2130 A.A2131 angle=105 distance=13.9 ratio=0.79 79 A.A2133 A.A2134 angle=139 distance=18.5 ratio=0.94 80 A.A2135 A.C2136 angle=87 distance=12.5 ratio=0.69 81 A.A2142 A.G2143 angle=125 distance=16.7 ratio=0.89 82 A.G2145 A.A2146 angle=142 distance=17.8 ratio=0.95 83 A.A2146 A.G2147 angle=156 distance=19.5 ratio=0.98 84 A.A2154 A.A2155 angle=142 distance=19.3 ratio=0.94 85 A.A2160 A.A2161 angle=166 distance=19.6 ratio=0.99 86 A.A2167 A.U2168 angle=95 distance=15.1 ratio=0.74 87 A.U2171 A.A2172 angle=97 distance=16.4 ratio=0.75 88 A.A2172 A.G2173 angle=123 distance=17.3 ratio=0.88 89 A.A2180 A.A2181 angle=110 distance=15.0 ratio=0.82 90 A.A2181 A.G2182 angle=113 distance=14.7 ratio=0.84 91 A.C2183 A.A2184 angle=164 distance=16.9 ratio=0.99 92 A.C2189 A.C2190 angle=93 distance=13.6 ratio=0.72 93 A.A2196 A.G2197 angle=96 distance=12.6 ratio=0.75 94 A.G2197 A.A2198 angle=133 distance=17.1 ratio=0.92 95 A.A2198 A.A2199 angle=108 distance=14.9 ratio=0.81 96 A.A2232 A.U2233 angle=160 distance=19.2 ratio=0.98 97 A.C2236 A.A2237 angle=94 distance=14.8 ratio=0.74 98 A.C2240 A.A2241 angle=96 distance=13.3 ratio=0.74 99 A.A2243 A.U2244 angle=100 distance=14.7 ratio=0.77 100 A.U2244 A.A2245 angle=148 distance=14.8 ratio=0.96 101 A.A2250 A.A2251 angle=110 distance=12.9 ratio=0.82 102 A.A2251 A.C2252 angle=90 distance=13.0 ratio=0.71 103 A.C2259 A.A2260 angle=130 distance=15.5 ratio=0.91 104 A.C2261 A.C2262 angle=128 distance=16.5 ratio=0.90 105 A.C2262 A.C2263 angle=139 distance=17.7 ratio=0.94 106 A.C2282 A.C2283 angle=165 distance=18.8 ratio=0.99 107 A.A2291 A.G2292 angle=121 distance=16.8 ratio=0.87 108 A.G2292 A.A2293 angle=138 distance=18.2 ratio=0.93 109 A.A2294 A.C2295 angle=109 distance=13.3 ratio=0.83 110 A.C2295 A.U2296 angle=139 distance=18.3 ratio=0.94 111 A.A2297 A.A2298 angle=115 distance=16.8 ratio=0.84 112 A.A2298 A.U2299 angle=146 distance=17.8 ratio=0.96 113 A.U2299 A.G2300 angle=154 distance=18.7 ratio=0.97 114 A.U2316 A.G2317 angle=121 distance=16.5 ratio=0.87 115 A.A2320 A.A2321 angle=101 distance=12.0 ratio=0.77 116 A.U2330 A.C2331 angle=142 distance=16.9 ratio=0.95 117 A.C2331 A.C2332 angle=116 distance=16.9 ratio=0.85 118 A.G2343 A.C2344 angle=146 distance=15.5 ratio=0.96 119 A.C2344 A.G2345 angle=147 distance=17.6 ratio=0.96 120 A.A2363 A.C2364 angle=126 distance=15.9 ratio=0.89 121 A.U2371 A.U2372 angle=90 distance=11.4 ratio=0.72 122 A.U2372 A.A2373 angle=90 distance=13.7 ratio=0.71 123 A.A2374 A.C2375 angle=97 distance=13.9 ratio=0.75 124 A.C2380 A.A2381 angle=104 distance=15.2 ratio=0.79 125 A.U2387 A.A2388 angle=169 distance=18.9 ratio=1.00 126 A.C2389 A.A2390 angle=168 distance=20.1 ratio=0.99 127 A.U2392 A.C2393 angle=109 distance=14.6 ratio=0.81 128 A.A2401 A.A2402 angle=104 distance=15.3 ratio=0.79 129 A.C2405 A.A2406 angle=118 distance=16.5 ratio=0.86 130 A.C2417 A.A2418 angle=97 distance=14.2 ratio=0.75 131 A.U2422 A.C2423 angle=134 distance=17.9 ratio=0.92 132 A.A2424 A.A2425 angle=128 distance=14.8 ratio=0.90 133 A.A2425 A.C2426 angle=104 distance=15.4 ratio=0.79 134 A.C2426 A.C2427 angle=99 distance=13.4 ratio=0.76 135 A.A2429 A.A2430 angle=107 distance=13.2 ratio=0.80 136 A.C2431 A.A2432 angle=100 distance=15.5 ratio=0.77 137 A.A2432 A.C2433 angle=149 distance=19.3 ratio=0.96 138 A.C2433 A.A2434 angle=125 distance=16.8 ratio=0.89 139 A.A2434 A.G2435 angle=136 distance=16.7 ratio=0.93 140 A.U2445 A.A2446 angle=122 distance=16.0 ratio=0.88 141 A.A2446 A.A2447 angle=99 distance=13.3 ratio=0.76 142 A.A2452 A.G2453 angle=137 distance=17.6 ratio=0.93 143 A.A2457 A.A2458 angle=86 distance=14.2 ratio=0.68 144 A.G2477 A.G2478 angle=107 distance=15.4 ratio=0.80 145 A.U2499 A.A2500 angle=130 distance=16.9 ratio=0.91 146 A.C2501 A.C2502 angle=119 distance=16.3 ratio=0.86 147 A.A2505 A.A2506 angle=92 distance=13.5 ratio=0.72 148 A.A2506 A.A2507 angle=115 distance=14.8 ratio=0.85 149 A.U2522 A.C2523 angle=137 distance=14.4 ratio=0.93 150 A.C2523 A.A2524 angle=86 distance=12.9 ratio=0.69 151 A.A2527 A.G2528 angle=109 distance=14.9 ratio=0.81 152 A.A2530 A.U2531 angle=163 distance=18.5 ratio=0.99 153 A.U2531 A.U2532 angle=119 distance=16.5 ratio=0.86 154 A.A2539 A.C2540 angle=116 distance=16.4 ratio=0.85 155 A.U2545 A.G2546 angle=111 distance=14.4 ratio=0.83 156 A.C2557 A.A2558 angle=126 distance=17.9 ratio=0.89 157 A.A2558 A.U2559 angle=105 distance=15.0 ratio=0.79 158 A.U2563 A.A2564 angle=176 distance=19.1 ratio=1.00 159 A.A2564 A.A2565 angle=145 distance=20.1 ratio=0.95 160 A.C2569 A.C2570 angle=132 distance=18.5 ratio=0.92 161 A.A2589 A.A2590 angle=98 distance=12.8 ratio=0.76 162 A.G2592 A.G2593 angle=104 distance=16.8 ratio=0.79 163 A.A2600 A.A2601 angle=114 distance=16.5 ratio=0.84 164 A.A2601 A.U2602 angle=104 distance=15.0 ratio=0.79 165 A.U2602 A.C2603 angle=136 distance=16.8 ratio=0.93 166 A.U2606 A.U2607 angle=123 distance=16.1 ratio=0.88 167 A.U2607 A.G2608 angle=159 distance=18.3 ratio=0.98 168 A.A2617 A.U2618 angle=125 distance=18.4 ratio=0.89 169 A.U2618 A.A2619 angle=139 distance=17.9 ratio=0.94 170 A.C2625 A.U2626 angle=105 distance=16.5 ratio=0.79 171 A.U2626 A.G2627 angle=146 distance=17.4 ratio=0.96 172 A.G2627 A.U2628 angle=117 distance=15.9 ratio=0.85 173 A.U2628 A.A2629 angle=145 distance=16.9 ratio=0.95 174 A.A2629 A.U2630 angle=162 distance=19.2 ratio=0.99 175 A.A2632 A.A2633 angle=89 distance=13.6 ratio=0.70 176 A.A2633 A.U2634 angle=147 distance=19.8 ratio=0.96 177 A.U2634 A.G2635 angle=114 distance=18.2 ratio=0.84 178 A.G2643 A.A2644 angle=153 distance=17.0 ratio=0.97 179 A.A2644 A.G2645 angle=145 distance=17.2 ratio=0.95 180 A.U2654 A.G2655 angle=100 distance=12.4 ratio=0.77 181 A.U2680 A.G2681 angle=126 distance=16.8 ratio=0.89 182 A.C2683 A.C2684 angle=116 distance=14.3 ratio=0.85 183 A.C2684 A.U2685 angle=113 distance=16.6 ratio=0.84 184 A.U2685 A.G2686 angle=162 distance=18.2 ratio=0.99 185 A.G2692 A.A2693 angle=100 distance=15.4 ratio=0.77 186 A.A2694 A.G2695 angle=134 distance=17.0 ratio=0.92 187 A.G2695 A.A2696 angle=167 distance=18.3 ratio=0.99 188 A.A2696 A.G2697 angle=88 distance=13.2 ratio=0.70 189 A.G2698 A.C2699 angle=111 distance=15.6 ratio=0.82 190 A.U2705 A.A2706 angle=132 distance=17.5 ratio=0.91 191 A.A2717 A.C2718 angle=138 distance=18.8 ratio=0.93 192 A.C2718 A.G2719 angle=137 distance=17.4 ratio=0.93 193 A.A2722 A.A2723 angle=107 distance=17.1 ratio=0.80 194 A.A2723 A.G2724 angle=128 distance=18.5 ratio=0.90 195 A.G2724 A.A2725 angle=94 distance=13.3 ratio=0.73 196 A.A2725 A.C2726 angle=115 distance=15.8 ratio=0.85 197 A.A2730 A.U2731 angle=110 distance=17.6 ratio=0.82 198 A.U2731 A.G2732 angle=135 distance=17.7 ratio=0.93 199 A.U2738 A.U2739 angle=118 distance=16.1 ratio=0.86 200 A.U2739 A.A2740 angle=159 distance=17.7 ratio=0.98 201 A.C2809 A.G2810 angle=138 distance=18.6 ratio=0.93 202 A.U2813 A.G2814 angle=170 distance=16.1 ratio=1.00 203 A.G2814 A.G2815 angle=153 distance=18.2 ratio=0.97 204 A.C2822 A.U2823 angle=108 distance=15.5 ratio=0.81 205 A.A2830 A.G2831 angle=147 distance=18.7 ratio=0.96 206 A.A2832 A.A2833 angle=94 distance=15.4 ratio=0.73 207 A.A2838 A.C2839 angle=134 distance=18.4 ratio=0.92 208 A.C2839 A.C2840 angle=128 distance=19.0 ratio=0.90 209 A.G2846 A.C2847 angle=115 distance=18.0 ratio=0.84 210 A.C2852 A.A2853 angle=172 distance=18.8 ratio=1.00 211 A.A2853 A.U2854 angle=143 distance=18.2 ratio=0.95 212 A.U2854 A.G2855 angle=120 distance=18.0 ratio=0.87 213 A.U2863 A.U2864 angle=96 distance=13.9 ratio=0.74 214 A.U2864 A.C2865 angle=131 distance=17.7 ratio=0.91 215 A.C2865 A.A2866 angle=104 distance=15.0 ratio=0.79 216 A.C2891 A.A2892 angle=97 distance=13.4 ratio=0.75 217 A.U2894 A.U2895 angle=111 distance=16.0 ratio=0.83 218 A.U2903 A.A2904 angle=89 distance=11.6 ratio=0.70 219 A.A2910 A.C2911 angle=143 distance=19.4 ratio=0.95 220 A.C2911 A.C2912 angle=137 distance=19.9 ratio=0.93 221 A.C2912 A.A2913 angle=110 distance=16.4 ratio=0.82 222 A.A2913 A.A2914 angle=159 distance=18.1 ratio=0.98 223 A.A2914 A.C2915 angle=115 distance=16.7 ratio=0.84 224 A.C2915 A.G2916 angle=143 distance=18.0 ratio=0.95 225 A.G2917 A.A2918 angle=137 distance=15.7 ratio=0.93 226 A.A2918 A.A2919 angle=102 distance=15.2 ratio=0.78 227 A.U2925 A.A2926 angle=170 distance=17.5 ratio=1.00 228 A.A2926 A.C2927 angle=134 distance=17.7 ratio=0.92 229 A.G2934 A.A2935 angle=141 distance=17.7 ratio=0.94 230 A.C2962 A.A2963 angle=95 distance=14.9 ratio=0.74 231 A.U2964 A.A2965 angle=148 distance=17.1 ratio=0.96 232 A.C2988 A.G2989 angle=146 distance=18.9 ratio=0.96 233 A.G2989 A.A2990 angle=111 distance=15.3 ratio=0.82 234 A.A2990 A.U2991 angle=99 distance=14.7 ratio=0.76 235 A.U2991 A.G2992 angle=90 distance=13.6 ratio=0.71 236 A.G2992 A.U2993 angle=100 distance=14.1 ratio=0.77 237 A.U2993 A.U2994 angle=112 distance=14.9 ratio=0.83 238 A.C3004 A.A3005 angle=97 distance=12.7 ratio=0.76 239 A.A3005 A.U3006 angle=109 distance=16.2 ratio=0.82 240 A.U3015 A.G3016 angle=136 distance=15.8 ratio=0.93 241 A.G3016 A.C3017 angle=104 distance=17.1 ratio=0.79 242 A.C3017 A.A3018 angle=119 distance=14.6 ratio=0.86 243 A.U3033 A.U3034 angle=135 distance=17.8 ratio=0.92 244 A.U3050 A.A3051 angle=88 distance=12.4 ratio=0.70 245 A.A3053 A.G3054 angle=116 distance=17.4 ratio=0.85 246 A.U3058 A.A3059 angle=158 distance=16.9 ratio=0.98 247 A.A3059 A.C3060 angle=155 distance=18.9 ratio=0.98 248 A.C3060 A.G3061 angle=145 distance=17.4 ratio=0.95 249 A.U3062 A.G3063 angle=105 distance=11.7 ratio=0.80 250 A.G3063 A.A3064 angle=122 distance=14.5 ratio=0.88 251 A.A3064 A.U3065 angle=115 distance=17.1 ratio=0.85 252 A.C3088 A.A3089 angle=156 distance=15.6 ratio=0.98 253 A.A3089 A.G3090 angle=127 distance=17.2 ratio=0.90 254 A.G3095 A.U3096 angle=113 distance=16.5 ratio=0.84 255 A.U3096 A.U3097 angle=117 distance=16.4 ratio=0.85 256 A.U3097 A.U3098 angle=91 distance=13.6 ratio=0.71 257 A.C3099 A.U3100 angle=119 distance=16.6 ratio=0.86 258 A.U3100 A.A3101 angle=135 distance=17.6 ratio=0.92 259 A.U3107 A.U3108 angle=110 distance=13.5 ratio=0.82 260 A.U3108 A.U3109 angle=127 distance=18.3 ratio=0.89 261 A.G3127 A.A3128 angle=86 distance=11.8 ratio=0.68 262 A.A3156 A.C3157 angle=118 distance=16.4 ratio=0.86 263 A.C3157 A.A3158 angle=117 distance=14.8 ratio=0.85 264 A.U3167 A.C3168 angle=99 distance=14.3 ratio=0.76 265 A.C3171 A.C3172 angle=88 distance=12.7 ratio=0.70 266 A.A3182 A.U3183 angle=135 distance=19.0 ratio=0.92 267 A.U3183 A.C3184 angle=147 distance=18.4 ratio=0.96 268 A.U3186 A.C3187 angle=116 distance=15.1 ratio=0.85 269 A.C3187 A.U3188 angle=130 distance=16.0 ratio=0.91 270 A.U3188 A.C3189 angle=145 distance=19.8 ratio=0.95 271 A.C3189 A.A3190 angle=159 distance=20.9 ratio=0.98 272 A.C3206 A.A3207 angle=96 distance=13.1 ratio=0.74 273 A.C3216 A.A3217 angle=92 distance=13.0 ratio=0.72 274 A.A3217 A.A3218 angle=91 distance=13.7 ratio=0.71 275 A.G3219 A.A3220 angle=115 distance=14.8 ratio=0.84 276 A.U3227 A.U3228 angle=142 distance=14.8 ratio=0.95 277 B.G1608 B.U1609 angle=170 distance=18.5 ratio=1.00 278 B.U1613 B.U1614 angle=141 distance=18.3 ratio=0.94 279 B.U1614 B.A1615 angle=168 distance=21.3 ratio=0.99 ---------------------------------------------------------------- Summary of 170 splayed-apart units 1 nts=2 AC A.A1688,A.C1689 2 nts=2 CU A.C1693,A.U1694 3 nts=2 CU A.C1699,A.U1700 4 nts=2 UA A.U1701,A.A1702 5 nts=3 CUA A.C1703,A.U1704,A.A1705 6 nts=2 CA A.C1707,A.A1708 7 nts=2 AA A.A1712,A.A1713 8 nts=2 CU A.C1715,A.U1716 9 nts=3 AAC A.A1723,A.A1724,A.C1725 10 nts=2 AU A.A1727,A.U1728 11 nts=4 GGCG A.G1747,A.G1748,A.C1749,A.G1750 12 nts=2 UG A.U1766,A.G1767 13 nts=3 GCG A.G1768,A.C1769,A.G1770 14 nts=3 AUA A.A1773,A.U1774,A.A1775 15 nts=2 AU A.A1779,A.U1780 16 nts=2 AG A.A1796,A.G1797 17 nts=2 AU A.A1798,A.U1799 18 nts=3 AAA A.A1803,A.A1804,A.A1805 19 nts=2 AU A.A1808,A.U1809 20 nts=2 AA A.A1820,A.A1821 21 nts=2 AU A.A1823,A.U1824 22 nts=2 GC A.G1826,A.C1827 23 nts=3 AUA A.A1842,A.U1843,A.A1844 24 nts=2 AA A.A1855,A.A1856 25 nts=2 AA A.A1859,A.A1860 26 nts=3 AGA A.A1885,A.G1886,A.A1887 27 nts=2 GC A.G1888,A.C1889 28 nts=3 AAA A.A1891,A.A1892,A.A1893 29 nts=2 CC A.C1902,A.C1903 30 nts=3 AGC A.A1917,A.G1918,A.C1919 31 nts=2 CA A.C1930,A.A1931 32 nts=3 AGA A.A1938,A.G1939,A.A1940 33 nts=3 UAG A.U1956,A.A1957,A.G1958 34 nts=3 AAA A.A1960,A.A1961,A.A1962 35 nts=2 AA A.A1971,A.A1972 36 nts=3 GAU A.G1973,A.A1974,A.U1975 37 nts=3 GAG A.G1985,A.A1986,A.G1987 38 nts=3 GAC A.G1990,A.A1991,A.C1992 39 nts=2 AA A.A1994,A.A1995 40 nts=4 CUAC A.C1997,A.U1998,A.A1999,A.C2000 41 nts=2 CG A.C2001,A.G2002 42 nts=2 AG A.A2003,A.G2004 43 nts=3 UGA A.U2010,A.G2011,A.A2012 44 nts=3 AGC A.A2014,A.G2015,A.C2016 45 nts=3 UUG A.U2020,A.U2021,A.G2022 46 nts=2 UA A.U2030,A.A2031 47 nts=2 UC A.U2035,A.C2036 48 nts=3 UAG A.U2038,A.A2039,A.G2040 49 nts=2 AA A.A2064,A.A2065 50 nts=2 AG A.A2097,A.G2098 51 nts=3 AAC A.A2109,A.A2110,A.C2111 52 nts=3 AGC A.A2112,A.G2113,A.C2114 53 nts=2 AA A.A2130,A.A2131 54 nts=2 AA A.A2133,A.A2134 55 nts=2 AC A.A2135,A.C2136 56 nts=2 AG A.A2142,A.G2143 57 nts=3 GAG A.G2145,A.A2146,A.G2147 58 nts=2 AA A.A2154,A.A2155 59 nts=2 AA A.A2160,A.A2161 60 nts=2 AU A.A2167,A.U2168 61 nts=3 UAG A.U2171,A.A2172,A.G2173 62 nts=3 AAG A.A2180,A.A2181,A.G2182 63 nts=2 CA A.C2183,A.A2184 64 nts=2 CC A.C2189,A.C2190 65 nts=4 AGAA A.A2196,A.G2197,A.A2198,A.A2199 66 nts=2 AU A.A2232,A.U2233 67 nts=2 CA A.C2236,A.A2237 68 nts=2 CA A.C2240,A.A2241 69 nts=3 AUA A.A2243,A.U2244,A.A2245 70 nts=3 AAC A.A2250,A.A2251,A.C2252 71 nts=2 CA A.C2259,A.A2260 72 nts=3 CCC A.C2261,A.C2262,A.C2263 73 nts=2 CC A.C2282,A.C2283 74 nts=3 AGA A.A2291,A.G2292,A.A2293 75 nts=3 ACU A.A2294,A.C2295,A.U2296 76 nts=4 AAUG A.A2297,A.A2298,A.U2299,A.G2300 77 nts=2 UG A.U2316,A.G2317 78 nts=2 AA A.A2320,A.A2321 79 nts=3 UCC A.U2330,A.C2331,A.C2332 80 nts=3 GCG A.G2343,A.C2344,A.G2345 81 nts=2 AC A.A2363,A.C2364 82 nts=3 UUA A.U2371,A.U2372,A.A2373 83 nts=2 AC A.A2374,A.C2375 84 nts=2 CA A.C2380,A.A2381 85 nts=2 UA A.U2387,A.A2388 86 nts=2 CA A.C2389,A.A2390 87 nts=2 UC A.U2392,A.C2393 88 nts=2 AA A.A2401,A.A2402 89 nts=2 CA A.C2405,A.A2406 90 nts=2 CA A.C2417,A.A2418 91 nts=2 UC A.U2422,A.C2423 92 nts=4 AACC A.A2424,A.A2425,A.C2426,A.C2427 93 nts=2 AA A.A2429,A.A2430 94 nts=5 CACAG A.C2431,A.A2432,A.C2433,A.A2434,A.G2435 95 nts=3 UAA A.U2445,A.A2446,A.A2447 96 nts=2 AG A.A2452,A.G2453 97 nts=2 AA A.A2457,A.A2458 98 nts=2 GG A.G2477,A.G2478 99 nts=2 UA A.U2499,A.A2500 100 nts=2 CC A.C2501,A.C2502 101 nts=3 AAA A.A2505,A.A2506,A.A2507 102 nts=3 UCA A.U2522,A.C2523,A.A2524 103 nts=2 AG A.A2527,A.G2528 104 nts=3 AUU A.A2530,A.U2531,A.U2532 105 nts=2 AC A.A2539,A.C2540 106 nts=2 UG A.U2545,A.G2546 107 nts=3 CAU A.C2557,A.A2558,A.U2559 108 nts=3 UAA A.U2563,A.A2564,A.A2565 109 nts=2 CC A.C2569,A.C2570 110 nts=2 AA A.A2589,A.A2590 111 nts=2 GG A.G2592,A.G2593 112 nts=4 AAUC A.A2600,A.A2601,A.U2602,A.C2603 113 nts=3 UUG A.U2606,A.U2607,A.G2608 114 nts=3 AUA A.A2617,A.U2618,A.A2619 115 nts=6 CUGUAU A.C2625,A.U2626,A.G2627,A.U2628,A.A2629,A.U2630 116 nts=4 AAUG A.A2632,A.A2633,A.U2634,A.G2635 117 nts=3 GAG A.G2643,A.A2644,A.G2645 118 nts=2 UG A.U2654,A.G2655 119 nts=2 UG A.U2680,A.G2681 120 nts=4 CCUG A.C2683,A.C2684,A.U2685,A.G2686 121 nts=2 GA A.G2692,A.A2693 122 nts=4 AGAG A.A2694,A.G2695,A.A2696,A.G2697 123 nts=2 GC A.G2698,A.C2699 124 nts=2 UA A.U2705,A.A2706 125 nts=3 ACG A.A2717,A.C2718,A.G2719 126 nts=5 AAGAC A.A2722,A.A2723,A.G2724,A.A2725,A.C2726 127 nts=3 AUG A.A2730,A.U2731,A.G2732 128 nts=3 UUA A.U2738,A.U2739,A.A2740 129 nts=2 CG A.C2809,A.G2810 130 nts=3 UGG A.U2813,A.G2814,A.G2815 131 nts=2 CU A.C2822,A.U2823 132 nts=2 AG A.A2830,A.G2831 133 nts=2 AA A.A2832,A.A2833 134 nts=3 ACC A.A2838,A.C2839,A.C2840 135 nts=2 GC A.G2846,A.C2847 136 nts=4 CAUG A.C2852,A.A2853,A.U2854,A.G2855 137 nts=4 UUCA A.U2863,A.U2864,A.C2865,A.A2866 138 nts=2 CA A.C2891,A.A2892 139 nts=2 UU A.U2894,A.U2895 140 nts=2 UA A.U2903,A.A2904 141 nts=7 ACCAACG A.A2910,A.C2911,A.C2912,A.A2913,A.A2914,A.C2915,A.G2916 142 nts=3 GAA A.G2917,A.A2918,A.A2919 143 nts=3 UAC A.U2925,A.A2926,A.C2927 144 nts=2 GA A.G2934,A.A2935 145 nts=2 CA A.C2962,A.A2963 146 nts=2 UA A.U2964,A.A2965 147 nts=7 CGAUGUU A.C2988,A.G2989,A.A2990,A.U2991,A.G2992,A.U2993,A.U2994 148 nts=3 CAU A.C3004,A.A3005,A.U3006 149 nts=4 UGCA A.U3015,A.G3016,A.C3017,A.A3018 150 nts=2 UU A.U3033,A.U3034 151 nts=2 UA A.U3050,A.A3051 152 nts=2 AG A.A3053,A.G3054 153 nts=4 UACG A.U3058,A.A3059,A.C3060,A.G3061 154 nts=4 UGAU A.U3062,A.G3063,A.A3064,A.U3065 155 nts=3 CAG A.C3088,A.A3089,A.G3090 156 nts=4 GUUU A.G3095,A.U3096,A.U3097,A.U3098 157 nts=3 CUA A.C3099,A.U3100,A.A3101 158 nts=3 UUU A.U3107,A.U3108,A.U3109 159 nts=2 GA A.G3127,A.A3128 160 nts=3 ACA A.A3156,A.C3157,A.A3158 161 nts=2 UC A.U3167,A.C3168 162 nts=2 CC A.C3171,A.C3172 163 nts=3 AUC A.A3182,A.U3183,A.C3184 164 nts=5 UCUCA A.U3186,A.C3187,A.U3188,A.C3189,A.A3190 165 nts=2 CA A.C3206,A.A3207 166 nts=3 CAA A.C3216,A.A3217,A.A3218 167 nts=2 GA A.G3219,A.A3220 168 nts=2 UU A.U3227,A.U3228 169 nts=2 GU B.G1608,B.U1609 170 nts=3 UUA B.U1613,B.U1614,B.A1615 **************************************************************************** This structure contains *2-order pseudoknot o You may want to run DSSR again with the '--nested' option which removes pseudoknots to get a fully nested secondary structure representation. **************************************************************************** Secondary structures in dot-bracket notation (dbn) as a whole and per chain >3j7y nts=1530 [whole] GCUAAACCUAGCCCCAAACCCACUCCACCUUACUACCAG&CAACCUUAGCCAAACCAUUUAC&AUAAAGUAUAGGCGAUAGAAAUUG&UGGCGCAAUAGAUAUAGUACCGCAAGGGAAAGAUGAAAAAUUAUAACCAAGCAUAAUAUAGCAAGGACUAACCCCUAUACCUUCUGCAUAAUGAAUUAACUAGAAAUAACUUUGCAAGGAGAGCCAAAGCUAAGACCCCCGAAACCAGACGAGCUACCUAAGAACAGCUA&AGAGCACACCCGUCUAUGUAGCAAAAUAGUGGGAAGAUUUAUAGGUAGAGGCGACAAACCUACCGAGCCUGGUGAUAGCUGGUUGUCCAAGAUAGAAUCUUAGUUCAACUUUAAAUUUGCCCACAGAACC&AAAUCCCCUUGUAAAUUUAACUGUUAGUCCAAAGAGGAACAGCUCUUUGGACACUAGGAAAAAACCUUGUAGAGAGAGUAAAAAAUUUAACACCCAUAGUAGGCCUAAAAGCAGCCACCAAUUAAGAAAGCGUUCAAGCUCAACACC&AAAAAUCCCAAACAUAUAACUGAACUCCUCACACCCAAUUGGACCAAUCUAUCACCCUAUAGAAGAACUAAUGUUAGUAUAAGUAACAUGAAAACAUUCUCCUCCGCAUAAGCCUGCGUCAGAU&CAC&ACUGACAAUUAACAGCCCAAUAUCUACAAUCAACCAACAAGUCAUUAUUACCCUCACUGUCAACCCAACACAGGCAUGCUCAUAAGGAAAGGUUAAAAAAAGUAAAAGGAACUCGGCAAAUCUUACCCCGCCUGUUUACCAAAAACAUCACCUCUAGCAUCACCAGUAUUAGAGGCACCGCCUGCCCAGUGACACAUGUUUAACGGCCGCGGU&UAACCGUGCAAAGGUAGCAUAAUCACUUGUUCCUUAAAUAGGGACCUGUAUGAAUGGCUCCACGAGGGUUCAGCUGUCUCUUACUUUUAACCAGUGAAAUUGACCUGCCCGUGAAGAGGCGGGCAUAACACAGCAAGACGAGAAGACCCUAUGGAGCUUUAAUUUAUUAAUGCAAACAGUA&ACCUGCAUUAAAAAUUUCGGUUGGGGCGACCUCGGAGCAGAACCCAACCUCCGAGCAGUACAUGCUAAGACUUCACCAGUCAAAGCGAAC&CUCAAUUGAUCCAAUAACUUGACCAACGGAACAAGUUACCCUAGGGAUAACAGCGCAAUCCUAUUCUAGAGUCCAUAUCAACAAUAGGGUUUACGACCUCGAUGUUGGAUCAGGACAUCCCGAUGGUGCAGCCGCUAUUAAAGGUUCGUUUGUUCAACGAUUAAAGUCCUACGUGAUCUGAGUUCAGACCGGAGUAAUCCAGGUCGGUUUCUAUCUACUUU&AUUCCUCCCUGUACGAAAGGACAAGAGAAAUAAGGCCUACUUCACAAAGCGCCUUCCCCCGUAAAUGAUAUCAUCUCAACUUAG&AUACCCA&CACCCAAGAACAGGGUU&C&AGAGUGUAGCUUAA&AAGCACCCAACUUACACUUAGGAGAU&UCAA&UUGA&CGCUCUGA&A ((.....(..((((.........................&...........(...[..)...&..(.....((.]...))....)..&.)).)).............((....))....).....(...)........)).........(.(((.......))).[.(.(........).).((((.(.........((..((..((....))...)).).)...((.(...((((.(.....(((((.((((.(((.&.[)))...(((..((((.......{)))).)))..).))).))))).(.((.......))...)..).))))......).))..((((((....((.(....)).).((.((((((((((.....((...&...)).....))))))))))..))..((((((((((......)))))))))).(.(((......))).)..(((.(((...(..............(.(..(((.........)))..).)....(..(((......))))......&....................)...))))))........))))))...(((((......))))).........)).)))(......((..(((....)))(((...((((......(.(((((..&...&.)))))......(((...((((...............(..)....)))).......))).)...((......)).))))......)))..((((....((((((..((..(....(........((((((.].((.........))....((((((.............))))))....(((.(((..((((((..))))..)))))(((((.&...)))))........((..........(((((.......)))))..)..)....)))....)).))))....)..))).).))))).)))).)).....)).{..(((((.....]}.))))).......((..(((.((......((((.((((((..(((((.(((.((((.......&...))))).)))))))..(((......[)))((((((..........]))))))(.((.....((...(((....[..)))...))....&)).........(((....))).....)].....))))..)))))).......(((..(.((((((.(.((.......)))..))))))...).)).)........((((.((((((..((.((((((......))))))...)).(((((.....))))).....)))))..)...))).).....(((((((....))).))))..}.))..))).))..&(((.(((......(....).....))).)))(((((...(((....))).)))))......(((................))).&.......&.((((.......)))).&(&((((((..(((...&.))).((.((.......)).))....&((((&))))&))))))).&. >3j7y-A #1 nts=1473 0.02(3.72) [chain] RNA* GCUAAACCUAGCCCCAAACCCACUCCACCUUACUACCAG&CAACCUUAGCCAAACCAUUUAC&AUAAAGUAUAGGCGAUAGAAAUUG&UGGCGCAAUAGAUAUAGUACCGCAAGGGAAAGAUGAAAAAUUAUAACCAAGCAUAAUAUAGCAAGGACUAACCCCUAUACCUUCUGCAUAAUGAAUUAACUAGAAAUAACUUUGCAAGGAGAGCCAAAGCUAAGACCCCCGAAACCAGACGAGCUACCUAAGAACAGCUA&AGAGCACACCCGUCUAUGUAGCAAAAUAGUGGGAAGAUUUAUAGGUAGAGGCGACAAACCUACCGAGCCUGGUGAUAGCUGGUUGUCCAAGAUAGAAUCUUAGUUCAACUUUAAAUUUGCCCACAGAACC&AAAUCCCCUUGUAAAUUUAACUGUUAGUCCAAAGAGGAACAGCUCUUUGGACACUAGGAAAAAACCUUGUAGAGAGAGUAAAAAAUUUAACACCCAUAGUAGGCCUAAAAGCAGCCACCAAUUAAGAAAGCGUUCAAGCUCAACACC&AAAAAUCCCAAACAUAUAACUGAACUCCUCACACCCAAUUGGACCAAUCUAUCACCCUAUAGAAGAACUAAUGUUAGUAUAAGUAACAUGAAAACAUUCUCCUCCGCAUAAGCCUGCGUCAGAU&CAC&ACUGACAAUUAACAGCCCAAUAUCUACAAUCAACCAACAAGUCAUUAUUACCCUCACUGUCAACCCAACACAGGCAUGCUCAUAAGGAAAGGUUAAAAAAAGUAAAAGGAACUCGGCAAAUCUUACCCCGCCUGUUUACCAAAAACAUCACCUCUAGCAUCACCAGUAUUAGAGGCACCGCCUGCCCAGUGACACAUGUUUAACGGCCGCGGU&UAACCGUGCAAAGGUAGCAUAAUCACUUGUUCCUUAAAUAGGGACCUGUAUGAAUGGCUCCACGAGGGUUCAGCUGUCUCUUACUUUUAACCAGUGAAAUUGACCUGCCCGUGAAGAGGCGGGCAUAACACAGCAAGACGAGAAGACCCUAUGGAGCUUUAAUUUAUUAAUGCAAACAGUA&ACCUGCAUUAAAAAUUUCGGUUGGGGCGACCUCGGAGCAGAACCCAACCUCCGAGCAGUACAUGCUAAGACUUCACCAGUCAAAGCGAAC&CUCAAUUGAUCCAAUAACUUGACCAACGGAACAAGUUACCCUAGGGAUAACAGCGCAAUCCUAUUCUAGAGUCCAUAUCAACAAUAGGGUUUACGACCUCGAUGUUGGAUCAGGACAUCCCGAUGGUGCAGCCGCUAUUAAAGGUUCGUUUGUUCAACGAUUAAAGUCCUACGUGAUCUGAGUUCAGACCGGAGUAAUCCAGGUCGGUUUCUAUCUACUUU&AUUCCUCCCUGUACGAAAGGACAAGAGAAAUAAGGCCUACUUCACAAAGCGCCUUCCCCCGUAAAUGAUAUCAUCUCAACUUAG&AUACCCA&CACCCAAGAACAGGGUU&A ((.....(..((((.........................&...........(...[..)...&..(.....((.]...))....)..&.)).)).............((....))....).....(...)........)).........(.(((.......))).[.(.(........).).((((.(.........((..((..((....))...)).).)...((.(...((((.(.....(((((.((((.(((.&.[)))...(((..((((.......{)))).)))..).))).))))).(.((.......))...)..).))))......).))..((((((....((.(....)).).((.((((((((((.....((...&...)).....))))))))))..))..((((((((((......)))))))))).(.(((......))).)..(((.(((...(..............(.(..(((.........)))..).)....(..(((......))))......&....................)...))))))........))))))...(((((......))))).........)).)))(......((..(((....)))(((...((((......(.(((((..&...&.)))))......(((...((((...............(..)....)))).......))).)...((......)).))))......)))..((((....((((((..((..(....(........((((((.].((.........))....((((((.............))))))....(((.(((..((((((..))))..)))))(((((.&...)))))........((..........(((((.......)))))..)..)....)))....)).))))....)..))).).))))).)))).)).....)).{..(((((.....]}.))))).......((..(((.((......((((.((((((..(((((.(((.((((.......&...))))).)))))))..(((......[)))((((((..........]))))))(.((.....((...(((....[..)))...))....&)).........(((....))).....)].....))))..)))))).......(((..(.((((((.(.((.......)))..))))))...).)).)........((((.((((((..((.((((((......))))))...)).(((((.....))))).....)))))..)...))).).....(((((((....))).))))..}.))..))).))..&(((.(((......(....).....))).)))(((((...(((....))).)))))......(((................))).&.......&.((((.......)))).&. >3j7y-B #2 nts=57 0.12(3.18) [chain] RNA* C&AGAGUGUAGCUUAA&AAGCACCCAACUUACACUUAGGAGAU&UCAA&UUGA&CGCUCUGA (&((((((..(((...&.))).((.((.......)).))....&((((&))))&))))))). **************************************************************************** Summary of structural features of 1530 nucleotides Note: the first five columns are: (1) serial number, (2) one-letter shorthand name, (3) dbn, (4) id string, (5) rmsd (~zero) of base ring atoms fitted against those in a standard base reference frame. The sixth (last) column contains a comma-separated list of features whose meanings are mostly self-explanatory, except for: turn: angle C1'(i-1)--C1'(i)--C1'(i+1) < 90 degrees break: no backbone linkage between O3'(i-1) and P(i) 1 G ( A.G1671 0.011 anti,~C2'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,phosphate 2 C ( A.C1672 0.015 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop,phosphate 3 U . A.U1673 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,phosphate 4 A . A.A1674 0.004 anti,~C3'-endo,BI,non-pair-contact,junction-loop 5 A . A.A1675 0.007 anti,~C3'-endo,BI,non-pair-contact,junction-loop 6 A . A.A1676 0.005 anti,~C3'-endo,non-pair-contact,junction-loop 7 C . A.C1677 0.003 anti,~C3'-endo,non-pair-contact,junction-loop 8 C ( A.C1678 0.008 anti,~C2'-endo,BI,isolated-canonical,non-pair-contact,helix-end,junction-loop,phosphate 9 U . A.U1679 0.005 anti,~C2'-endo,non-canonical,non-pair-contact,helix,junction-loop,phosphate 10 A . A.A1680 0.005 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,junction-loop,phosphate 11 G ( A.G1681 0.014 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor,phosphate 12 C ( A.C1682 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 13 C ( A.C1683 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 14 C ( A.C1684 0.005 anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack 15 C . A.C1685 0.010 anti,~C3'-endo,non-pair-contact,ss-non-loop 16 A . A.A1686 0.002 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop 17 A . A.A1687 0.003 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop 18 A . A.A1688 0.003 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,phosphate,splayed-apart 19 C . A.C1689 0.003 syn,~C3'-endo,BI,non-stack,ss-non-loop,splayed-apart 20 C . A.C1690 0.003 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop 21 C . A.C1691 0.003 anti,~C3'-endo,non-pair-contact,ss-non-loop 22 A . A.A1692 0.003 anti,~C3'-endo,non-pair-contact,ss-non-loop 23 C . A.C1693 0.003 syn,~C3'-endo,BI,non-pair-contact,ss-non-loop,splayed-apart 24 U . A.U1694 0.005 turn,anti,~C3'-endo,non-stack,ss-non-loop,splayed-apart 25 C . A.C1695 0.004 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,phosphate 26 C . A.C1696 0.003 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,phosphate 27 A . A.A1697 0.003 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,phosphate 28 C . A.C1698 0.008 anti,~C3'-endo,BII,non-canonical,non-pair-contact,ss-non-loop,phosphate 29 C . A.C1699 0.003 turn,syn,~C2'-endo,non-stack,non-pair-contact,ss-non-loop,splayed-apart 30 U . A.U1700 0.006 anti,~C2'-endo,non-pair-contact,ss-non-loop,phosphate,splayed-apart 31 U . A.U1701 0.002 turn,syn,~C2'-endo,BI,non-pair-contact,ss-non-loop,splayed-apart 32 A . A.A1702 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,ss-non-loop,phosphate,splayed-apart 33 C . A.C1703 0.007 turn,anti,~C3'-endo,non-pair-contact,ss-non-loop,splayed-apart 34 U . A.U1704 0.003 anti,~C2'-endo,non-pair-contact,ss-non-loop,phosphate,splayed-apart 35 A . A.A1705 0.005 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,splayed-apart 36 C . A.C1706 0.003 anti,~C3'-endo,non-pair-contact,ss-non-loop,phosphate 37 C . A.C1707 0.006 syn,~C2'-endo,BII,ss-non-loop,splayed-apart 38 A . A.A1708 0.005 anti,~C2'-endo,non-stack,non-pair-contact,ss-non-loop,phosphate,splayed-apart 39 G . A.G1709 0.003 break,syn,~C3'-endo,non-stack,non-pair-contact,ss-non-loop,phosphate 40 C . A.C1711 0.005 anti,~C3'-endo,non-stack,non-pair-contact,ss-non-loop,phosphate 41 A . A.A1712 0.004 anti,~C2'-endo,non-pair-contact,ss-non-loop,phosphate,splayed-apart 42 A . A.A1713 0.004 anti,~C3'-endo,non-pair-contact,ss-non-loop,splayed-apart 43 C . A.C1714 0.004 syn,~C2'-endo,non-pair-contact,ss-non-loop,phosphate 44 C . A.C1715 0.004 syn,~C3'-endo,non-stack,non-pair-contact,ss-non-loop,phosphate,splayed-apart 45 U . A.U1716 0.005 syn,~C2'-endo,BI,non-stack,non-pair-contact,ss-non-loop,phosphate,splayed-apart 46 U . A.U1717 0.006 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop 47 A . A.A1718 0.009 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,ss-non-loop,A-minor,ribose-zipper,phosphate 48 G . A.G1719 0.008 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,ss-non-loop,ribose-zipper 49 C . A.C1720 0.029 anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,ss-non-loop 50 C . A.C1721 0.005 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop 51 A ( A.A1722 0.003 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,A-minor,kissing-loop 52 A . A.A1723 0.005 turn,anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,kissing-loop,splayed-apart 53 A . A.A1724 0.011 turn,syn,~C2'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor,kissing-loop,phosphate,splayed-apart 54 C . A.C1725 0.005 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,kissing-loop,cap-donor,phosphate,splayed-apart 55 C [ A.C1726 0.003 pseudoknotted,anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,hairpin-loop,kissing-loop,phosphate 56 A . A.A1727 0.011 anti,~C2'-endo,non-pair-contact,hairpin-loop,kissing-loop,phosphate,splayed-apart 57 U . A.U1728 0.006 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,kissing-loop,splayed-apart 58 U ) A.U1729 0.003 anti,~C3'-endo,BI,isolated-canonical,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,A-minor,kissing-loop,phosphate 59 U . A.U1730 0.005 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop,phosphate 60 A . A.A1731 0.003 anti,~C3'-endo,non-pair-contact,ss-non-loop,phosphate 61 C . A.C1732 0.004 break,syn,~C2'-endo,non-stack,non-pair-contact,ss-non-loop,phosphate 62 A . A.A1737 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,ss-non-loop 63 U . A.U1738 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop,phosphate 64 A ( A.A1739 0.003 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,internal-loop 65 A . A.A1740 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate 66 A . A.A1741 0.008 anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,internal-loop,phosphate 67 G . A.G1742 0.007 turn,anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,internal-loop 68 U . A.U1743 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate 69 A . A.A1744 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 70 U ( A.U1745 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop 71 A ( A.A1746 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop,kissing-loop,phosphate 72 G . A.G1747 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,kissing-loop,phosphate,splayed-apart 73 G ] A.G1748 0.003 pseudoknotted,turn,anti,~C3'-endo,isolated-canonical,non-pair-contact,hairpin-loop,kissing-loop,phosphate,splayed-apart 74 C . A.C1749 0.003 turn,anti,~C2'-endo,non-pair-contact,hairpin-loop,kissing-loop,phosphate,splayed-apart 75 G . A.G1750 0.012 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,kissing-loop,phosphate,splayed-apart 76 A . A.A1751 0.008 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,A-minor,kissing-loop,phosphate 77 U ) A.U1752 0.003 anti,~C3'-endo,BI,non-stack,canonical,helix,stem-end,hairpin-loop,kissing-loop,phosphate 78 A ) A.A1753 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop,phosphate 79 G . A.G1754 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 80 A . A.A1755 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate 81 A . A.A1756 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 82 A . A.A1757 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate 83 U ) A.U1758 0.005 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,internal-loop 84 U . A.U1759 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,ss-non-loop 85 G . A.G1760 0.003 break,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop,phosphate 86 U . A.U1766 0.003 anti,~C2'-endo,non-pair-contact,ss-non-loop,phosphate,splayed-apart 87 G ) A.G1767 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,splayed-apart 88 G ) A.G1768 0.007 anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,splayed-apart 89 C . A.C1769 0.004 turn,anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,bulge,splayed-apart 90 G ) A.G1770 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,splayed-apart 91 C ) A.C1771 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor,phosphate 92 A . A.A1772 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,junction-loop 93 A . A.A1773 0.006 anti,~C2'-endo,non-canonical,non-pair-contact,helix,junction-loop,phosphate,splayed-apart 94 U . A.U1774 0.008 turn,anti,~C2'-endo,non-stack,junction-loop,splayed-apart 95 A . A.A1775 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,junction-loop,A-minor,phosphate,splayed-apart 96 G . A.G1776 0.008 anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,phosphate 97 A . A.A1777 0.007 anti,BI,non-pair-contact,junction-loop 98 U . A.U1778 0.006 turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,junction-loop,phosphate 99 A . A.A1779 0.006 anti,~C3'-endo,non-pair-contact,junction-loop,phosphate,splayed-apart 100 U . A.U1780 0.003 turn,anti,~C3'-endo,non-pair-contact,junction-loop,phosphate,splayed-apart 101 A . A.A1781 0.006 anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,phosphate 102 G . A.G1782 0.010 turn,anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,junction-loop 103 U . A.U1783 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,junction-loop,phosphate 104 A . A.A1784 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop 105 C ( A.C1785 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop 106 C ( A.C1786 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop 107 G . A.G1787 0.009 u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,cap-acceptor 108 C . A.C1788 0.010 turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 109 A . A.A1789 0.012 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor,cap-donor,phosphate 110 A . A.A1790 0.005 u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,A-minor,phosphate 111 G ) A.G1791 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop,phosphate 112 G ) A.G1792 0.006 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,junction-loop,phosphate 113 G . A.G1793 0.005 anti,~C3'-endo,non-canonical,non-pair-contact,helix,junction-loop,phosphate 114 A . A.A1794 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,junction-loop,phosphate 115 A . A.A1795 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,phosphate 116 A . A.A1796 0.006 anti,~C2'-endo,BI,non-pair-contact,junction-loop,splayed-apart 117 G ) A.G1797 0.005 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix-end,junction-loop,splayed-apart 118 A . A.A1798 0.002 anti,non-pair-contact,junction-loop,splayed-apart 119 U . A.U1799 0.002 anti,~C3'-endo,non-stack,non-canonical,non-pair-contact,multiplet,junction-loop,splayed-apart 120 G . A.G1800 0.006 u-turn,anti,~C3'-endo,non-stack,non-canonical,non-pair-contact,junction-loop 121 A . A.A1801 0.007 turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,junction-loop 122 A . A.A1802 0.006 u-turn,anti,non-pair-contact,junction-loop,phosphate 123 A ( A.A1803 0.002 turn,u-turn,anti,~C2'-endo,isolated-canonical,non-canonical,non-pair-contact,multiplet,hairpin-loop,junction-loop,phosphate,splayed-apart 124 A . A.A1804 0.005 turn,anti,~C2'-endo,non-stack,hairpin-loop,phosphate,splayed-apart 125 A . A.A1805 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,hairpin-loop,phosphate,splayed-apart 126 U . A.U1806 0.003 turn,syn,~C2'-endo,non-pair-contact,hairpin-loop,phosphate 127 U ) A.U1807 0.007 syn,~C2'-endo,isolated-canonical,non-pair-contact,multiplet,hairpin-loop,junction-loop,phosphate 128 A . A.A1808 0.010 anti,~C2'-endo,non-pair-contact,junction-loop,splayed-apart 129 U . A.U1809 0.005 ~C3'-endo,non-stack,non-pair-contact,junction-loop,splayed-apart 130 A . A.A1810 0.002 anti,BI,non-pair-contact,junction-loop,phosphate 131 A . A.A1811 0.003 anti,~C3'-endo,BI,non-pair-contact,junction-loop 132 C . A.C1812 0.002 anti,~C3'-endo,non-pair-contact,junction-loop,phosphate 133 C . A.C1813 0.006 syn,~C3'-endo,non-stack,non-pair-contact,junction-loop 134 A . A.A1814 0.005 anti,~C3'-endo,BI,non-pair-contact,junction-loop,A-minor,ribose-zipper 135 A . A.A1815 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,A-minor,ribose-zipper,phosphate 136 G ) A.G1816 0.008 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,junction-loop,phosphate 137 C ) A.C1817 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,phosphate 138 A . A.A1818 0.005 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,phosphate 139 U . A.U1819 0.005 anti,~C3'-endo,non-pair-contact,ss-non-loop,phosphate 140 A . A.A1820 0.013 anti,~C2'-endo,non-pair-contact,ss-non-loop,splayed-apart 141 A . A.A1821 0.004 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,splayed-apart 142 U . A.U1822 0.007 anti,~C3'-endo,non-pair-contact,ss-non-loop,ribose-zipper,phosphate 143 A . A.A1823 0.003 anti,non-pair-contact,ss-non-loop,ribose-zipper,phosphate,splayed-apart 144 U . A.U1824 0.006 anti,~C2'-endo,BI,non-pair-contact,ss-non-loop,phosphate,splayed-apart 145 A . A.A1825 0.002 anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop,cap-donor 146 G . A.G1826 0.002 anti,~C3'-endo,BII,non-canonical,non-pair-contact,helix,ss-non-loop,cap-acceptor,splayed-apart 147 C ( A.C1827 0.007 turn,anti,~C2'-endo,isolated-canonical,non-pair-contact,helix,splayed-apart 148 A . A.A1828 0.004 turn,anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,ss-non-loop,A-minor,phosphate 149 A ( A.A1829 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,phosphate 150 G ( A.G1830 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 151 G ( A.G1831 0.006 anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop,cap-acceptor,phosphate 152 A . A.A1832 0.003 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-donor,phosphate 153 C . A.C1833 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,hairpin-loop,cap-acceptor,phosphate 154 U . A.U1834 0.006 turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,phosphate 155 A . A.A1835 0.003 syn,~C3'-endo,non-canonical,non-pair-contact,hairpin-loop,cap-donor,phosphate 156 A . A.A1836 0.002 turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,phosphate 157 C . A.C1837 0.003 syn,~C3'-endo,non-pair-contact,hairpin-loop,phosphate 158 C . A.C1838 0.002 anti,~C3'-endo,non-pair-contact,hairpin-loop,phosphate 159 C ) A.C1839 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop 160 C ) A.C1840 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 161 U ) A.U1841 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end 162 A . A.A1842 0.004 anti,~C3'-endo,non-pair-contact,ss-non-loop,splayed-apart 163 U [ A.U1843 0.008 pseudoknotted,turn,anti,~C2'-endo,BII,isolated-canonical,non-pair-contact,multiplet,cap-acceptor,splayed-apart 164 A . A.A1844 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,ss-non-loop,phosphate,splayed-apart 165 C ( A.C1845 0.006 anti,~C3'-endo,BI,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,internal-loop,A-minor 166 C . A.C1846 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,cap-donor,phosphate 167 U ( A.U1847 0.003 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,hairpin-loop,internal-loop 168 U . A.U1848 0.006 anti,~C3'-endo,non-pair-contact,hairpin-loop,phosphate 169 C . A.C1849 0.002 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor,phosphate 170 U . A.U1850 0.006 turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,phosphate 171 G . A.G1851 0.002 anti,~C3'-endo,non-pair-contact,hairpin-loop,cap-donor,phosphate 172 C . A.C1852 0.007 anti,~C2'-endo,BII,non-pair-contact,hairpin-loop,phosphate 173 A . A.A1853 0.008 turn,anti,~C3'-endo,non-canonical,non-pair-contact,hairpin-loop,phosphate 174 U . A.U1854 0.002 anti,~C2'-endo,non-pair-contact,hairpin-loop,cap-acceptor,phosphate 175 A . A.A1855 0.010 turn,anti,~C2'-endo,non-stack,non-pair-contact,hairpin-loop,splayed-apart 176 A ) A.A1856 0.005 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,hairpin-loop,internal-loop,phosphate,splayed-apart 177 U . A.U1857 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,cap-donor 178 G ) A.G1858 0.011 anti,~C3'-endo,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,internal-loop,A-minor,phosphate 179 A . A.A1859 0.006 anti,~C3'-endo,non-canonical,non-pair-contact,helix,ss-non-loop,cap-acceptor,phosphate,splayed-apart 180 A ( A.A1860 0.005 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,cap-donor,splayed-apart 181 U ( A.U1861 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,ribose-zipper,phosphate 182 U ( A.U1862 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,A-minor,ribose-zipper,phosphate 183 A ( A.A1863 0.016 anti,~C3'-endo,isolated-canonical,non-canonical,non-pair-contact,helix,bulge 184 A . A.A1864 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,bulge 185 C ( A.C1865 0.018 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,bulge,junction-loop,phosphate 186 U . A.U1866 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,junction-loop 187 A . A.A1867 0.004 anti,~C3'-endo,BII,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,A-minor 188 G . A.G1868 0.002 syn,~C2'-endo,non-canonical,non-pair-contact,helix-end,junction-loop,cap-acceptor,phosphate 189 A . A.A1869 0.004 anti,~C2'-endo,BII,non-pair-contact,junction-loop 190 A . A.A1870 0.006 anti,~C3'-endo,non-pair-contact,junction-loop 191 A . A.A1871 0.010 ~C2'-endo,non-canonical,non-pair-contact,junction-loop,phosphate 192 U . A.U1872 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,junction-loop 193 A . A.A1873 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,junction-loop,phosphate 194 A . A.A1874 0.006 anti,~C3'-endo,non-canonical,non-pair-contact,junction-loop 195 C ( A.C1875 0.022 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,bulge,junction-loop 196 U ( A.U1876 0.011 anti,~C3'-endo,BI,isolated-canonical,non-canonical,non-pair-contact,helix,bulge,internal-loop 197 U . A.U1877 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,internal-loop 198 U . A.U1878 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 199 G ( A.G1879 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop,phosphate 200 C ( A.C1880 0.017 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,internal-loop 201 A . A.A1881 0.003 anti,~C3'-endo,BI,non-pair-contact,internal-loop,phosphate 202 A . A.A1882 0.003 turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,internal-loop,phosphate 203 G ( A.G1883 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop,phosphate 204 G ( A.G1884 0.005 anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop,phosphate 205 A . A.A1885 0.008 anti,~C3'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart 206 G . A.G1886 0.004 turn,anti,~C2'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart 207 A . A.A1887 0.004 anti,BI,non-stack,non-pair-contact,hairpin-loop,phosphate,splayed-apart 208 G . A.G1888 0.010 anti,~C2'-endo,BI,non-stack,non-canonical,non-pair-contact,multiplet,hairpin-loop,splayed-apart 209 C ) A.C1889 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop,phosphate,splayed-apart 210 C ) A.C1890 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop,phosphate 211 A . A.A1891 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,internal-loop,phosphate,splayed-apart 212 A . A.A1892 0.005 turn,syn,~C2'-endo,non-pair-contact,internal-loop,phosphate,splayed-apart 213 A . A.A1893 0.005 anti,~C2'-endo,non-pair-contact,internal-loop,phosphate,splayed-apart 214 G ) A.G1894 0.008 anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,internal-loop,phosphate 215 C ) A.C1895 0.020 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop,phosphate 216 U . A.U1896 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 217 A ) A.A1897 0.014 anti,~C3'-endo,isolated-canonical,non-canonical,non-pair-contact,helix,bulge,internal-loop 218 A . A.A1898 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,bulge 219 G ) A.G1899 0.019 anti,~C3'-endo,BI,isolated-canonical,non-canonical,non-pair-contact,helix,bulge,junction-loop 220 A . A.A1900 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,junction-loop 221 C . A.C1901 0.008 syn,~C3'-endo,non-canonical,non-pair-contact,junction-loop,phosphate 222 C . A.C1902 0.009 syn,~C3'-endo,non-pair-contact,junction-loop,phosphate,splayed-apart 223 C ( A.C1903 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor,cap-donor,phosphate,splayed-apart 224 C ( A.C1904 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,A-minor,phosphate 225 C . A.C1905 0.009 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate 226 G ( A.G1906 0.011 anti,~C3'-endo,isolated-canonical,non-pair-contact,helix,internal-loop,phosphate 227 A . A.A1907 0.008 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,A-minor,ribose-zipper,phosphate 228 A . A.A1908 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,A-minor,ribose-zipper,cap-acceptor 229 A . A.A1909 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,internal-loop,cap-donor 230 C ( A.C1910 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,ribose-zipper 231 C ( A.C1911 0.004 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,ribose-zipper 232 A ( A.A1912 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 233 G ( A.G1913 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 234 A . A.A1914 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,A-minor 235 C ( A.C1915 0.006 anti,~C3'-endo,BI,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,internal-loop,junction-loop,A-minor 236 G . A.G1916 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,junction-loop,phosphate 237 A . A.A1917 0.005 turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,junction-loop,A-minor,phosphate,splayed-apart 238 G . A.G1918 0.004 turn,syn,~C2'-endo,non-canonical,non-pair-contact,junction-loop,phosphate,splayed-apart 239 C . A.C1919 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,junction-loop,cap-acceptor,splayed-apart 240 U . A.U1920 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,junction-loop 241 A ( A.A1921 0.006 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 242 C ( A.C1922 0.014 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 243 C ( A.C1923 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 244 U ( A.U1924 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 245 A ( A.A1925 0.003 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 246 A . A.A1926 0.008 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 247 G ( A.G1927 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 248 A ( A.A1928 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 249 A ( A.A1929 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 250 C ( A.C1930 0.003 anti,~C3'-endo,isolated-canonical,non-pair-contact,helix-end,bulge,junction-loop,splayed-apart 251 A . A.A1931 0.009 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop,cap-acceptor,splayed-apart 252 G ( A.G1932 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,cap-donor 253 C ( A.C1933 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 254 U ( A.U1934 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack 255 A . A.A1935 0.002 break,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop 256 A . A.A1938 0.004 syn,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,ss-non-loop,splayed-apart 257 G [ A.G1939 0.010 pseudoknotted,turn,syn,~C3'-endo,isolated-canonical,non-pair-contact,helix-end,multiplet,phosphate,splayed-apart 258 A ) A.A1940 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,phosphate,splayed-apart 259 G ) A.G1941 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 260 C ) A.C1942 0.018 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate 261 A . A.A1943 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop 262 C . A.C1944 0.004 anti,~C3'-endo,non-pair-contact,junction-loop,phosphate 263 A . A.A1945 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop,phosphate 264 C ( A.C1946 0.004 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 265 C ( A.C1947 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 266 C ( A.C1948 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,A-minor 267 G . A.G1949 0.004 anti,~C2'-endo,BII,non-canonical,non-pair-contact,multiplet,internal-loop 268 U . A.U1950 0.009 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,cap-donor,phosphate 269 C ( A.C1951 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 270 U ( A.U1952 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 271 A ( A.A1953 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 272 U ( A.U1954 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop 273 G . A.G1955 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate 274 U . A.U1956 0.002 anti,non-pair-contact,hairpin-loop,cap-acceptor,splayed-apart 275 A . A.A1957 0.006 turn,anti,~C2'-endo,non-stack,non-pair-contact,hairpin-loop,cap-acceptor,splayed-apart 276 G . A.G1958 0.003 anti,BI,non-pair-contact,hairpin-loop,cap-donor,phosphate,splayed-apart 277 C . A.C1959 0.005 turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,cap-acceptor 278 A . A.A1960 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate,splayed-apart 279 A . A.A1961 0.002 turn,anti,~C3'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart 280 A { A.A1962 0.005 pseudoknotted,anti,~C2'-endo,isolated-canonical,non-pair-contact,hairpin-loop,cap-acceptor,phosphate,splayed-apart 281 A ) A.A1963 0.004 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop 282 U ) A.U1964 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 283 A ) A.A1965 0.005 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 284 G ) A.G1966 0.004 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 285 U . A.U1967 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop 286 G ) A.G1968 0.005 anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,A-minor 287 G ) A.G1969 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,cap-donor 288 G ) A.G1970 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 289 A . A.A1971 0.002 anti,~C3'-endo,BII,non-canonical,non-pair-contact,helix,junction-loop,phosphate,splayed-apart 290 A . A.A1972 0.002 turn,anti,~C2'-endo,non-pair-contact,junction-loop,cap-donor,splayed-apart 291 G ) A.G1973 0.003 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix-end,bulge,junction-loop,cap-acceptor,splayed-apart 292 A . A.A1974 0.006 turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,bulge,phosphate,splayed-apart 293 U ) A.U1975 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,splayed-apart 294 U ) A.U1976 0.003 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 295 U ) A.U1977 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 296 A . A.A1978 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 297 U ) A.U1979 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 298 A ) A.A1980 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 299 G ) A.G1981 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 300 G ) A.G1982 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 301 U ) A.U1983 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate 302 A . A.A1984 0.004 ~C2'-endo,BII,non-canonical,non-pair-contact,multiplet,junction-loop,phosphate 303 G ( A.G1985 0.009 anti,~C2'-endo,BII,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,internal-loop,junction-loop,phosphate,splayed-apart 304 A . A.A1986 0.003 turn,anti,~C2'-endo,non-stack,non-pair-contact,internal-loop,phosphate,splayed-apart 305 G ( A.G1987 0.005 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,splayed-apart 306 G ( A.G1988 0.003 anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,A-minor 307 C . A.C1989 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop,phosphate 308 G . A.G1990 0.003 anti,~C3'-endo,BII,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate,splayed-apart 309 A . A.A1991 0.007 turn,anti,~C3'-endo,BII,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor,splayed-apart 310 C . A.C1992 0.008 turn,anti,~C2'-endo,non-pair-contact,hairpin-loop,cap-donor,phosphate,splayed-apart 311 A . A.A1993 0.010 turn,syn,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor,phosphate 312 A . A.A1994 0.005 turn,anti,~C3'-endo,non-canonical,non-pair-contact,hairpin-loop,A-minor,phosphate,splayed-apart 313 A . A.A1995 0.008 anti,~C3'-endo,non-canonical,non-pair-contact,helix,hairpin-loop,phosphate,splayed-apart 314 C ) A.C1996 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,A-minor 315 C ) A.C1997 0.008 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,phosphate,splayed-apart 316 U . A.U1998 0.009 anti,~C2'-endo,non-canonical,non-pair-contact,internal-loop,cap-donor,phosphate,splayed-apart 317 A . A.A1999 0.005 anti,~C2'-endo,non-pair-contact,internal-loop,phosphate,splayed-apart 318 C . A.C2000 0.005 anti,~C3'-endo,non-stack,internal-loop,splayed-apart 319 C ) A.C2001 0.011 anti,~C2'-endo,BII,isolated-canonical,non-pair-contact,helix,multiplet,internal-loop,junction-loop,splayed-apart 320 G . A.G2002 0.006 turn,anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,splayed-apart 321 A . A.A2003 0.005 anti,~C2'-endo,BII,non-stack,non-canonical,non-pair-contact,junction-loop,phosphate,splayed-apart 322 G ) A.G2004 0.009 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,multiplet,internal-loop,junction-loop,A-minor,splayed-apart 323 C . A.C2005 0.016 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,A-minor 324 C ) A.C2006 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 325 U ) A.U2007 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 326 G ) A.G2008 0.006 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 327 G ) A.G2009 0.006 anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,phosphate 328 U . A.U2010 0.013 anti,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,internal-loop,cap-acceptor,phosphate,splayed-apart 329 G . A.G2011 0.002 turn,anti,~C2'-endo,non-pair-contact,internal-loop,phosphate,splayed-apart 330 A . A.A2012 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,internal-loop,cap-donor,splayed-apart 331 U . A.U2013 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate 332 A . A.A2014 0.003 anti,~C3'-endo,BII,non-pair-contact,internal-loop,splayed-apart 333 G . A.G2015 0.006 turn,anti,~C2'-endo,non-pair-contact,internal-loop,cap-acceptor,splayed-apart 334 C ) A.C2016 0.012 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,internal-loop,phosphate,splayed-apart 335 U . A.U2017 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate 336 G ) A.G2018 0.006 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,A-minor 337 G ) A.G2019 0.005 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor,phosphate 338 U . A.U2020 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,junction-loop,splayed-apart 339 U . A.U2021 0.007 anti,~C2'-endo,BI,non-pair-contact,junction-loop,phosphate,splayed-apart 340 G ( A.G2022 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,cap-donor,splayed-apart 341 U ( A.U2023 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 342 C ( A.C2024 0.003 anti,~C3'-endo,BI,non-stack,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 343 C ( A.C2025 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 344 A ( A.A2026 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 345 A ( A.A2027 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate 346 G . A.G2028 0.008 anti,~C3'-endo,non-canonical,non-pair-contact,helix,junction-loop 347 A . A.A2029 0.005 anti,BI,non-pair-contact,junction-loop 348 U . A.U2030 0.005 anti,~C3'-endo,BII,non-stack,non-canonical,non-pair-contact,junction-loop,phosphate,splayed-apart 349 A . A.A2031 0.005 anti,~C3'-endo,non-stack,non-canonical,helix,junction-loop,splayed-apart 350 G ( A.G2032 0.010 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix-end,bulge,junction-loop 351 A ( A.A2033 0.016 anti,~C3'-endo,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,bulge 352 A . A.A2034 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,bulge,A-minor,cap-donor 353 U ( A.U2035 0.004 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,bulge,A-minor,splayed-apart 354 C . A.C2036 0.004 turn,anti,~C3'-endo,non-pair-contact,hairpin-loop,cap-donor,phosphate,splayed-apart 355 U . A.U2037 0.002 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-acceptor,phosphate 356 U . A.U2038 0.005 anti,~C3'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart 357 A . A.A2039 0.002 turn,anti,~C2'-endo,non-stack,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor,splayed-apart 358 G ) A.G2040 0.004 anti,~C3'-endo,BI,isolated-canonical,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,bulge,A-minor,phosphate,splayed-apart 359 U ) A.U2041 0.013 anti,~C3'-endo,BI,isolated-canonical,non-canonical,non-pair-contact,helix,bulge,phosphate 360 U . A.U2042 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,bulge,phosphate 361 C ) A.C2043 0.013 anti,~C3'-endo,non-stack,isolated-canonical,non-pair-contact,helix-end,bulge,junction-loop 362 A . A.A2044 0.008 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop 363 A ( A.A2045 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 364 C ( A.C2046 0.014 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,A-minor 365 U . A.U2047 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 366 U ( A.U2048 0.003 anti,~C3'-endo,BI,non-stack,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 367 U ( A.U2049 0.003 anti,~C3'-endo,BI,non-stack,canonical,helix,stem,coaxial-stack 368 A ( A.A2050 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 369 A ( A.A2051 0.003 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 370 A ( A.A2052 0.004 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 371 U ( A.U2053 0.012 anti,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 372 U ( A.U2054 0.006 anti,~C2'-endo,BII,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack 373 U ( A.U2055 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack 374 G ( A.G2056 0.006 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 375 C ( A.C2057 0.010 anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 376 C . A.C2058 0.006 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop 377 C . A.C2059 0.003 anti,~C2'-endo,non-canonical,non-pair-contact,helix,internal-loop 378 A . A.A2060 0.011 anti,~C2'-endo,non-canonical,non-pair-contact,helix,internal-loop 379 C . A.C2061 0.003 syn,~C3'-endo,BI,non-pair-contact,internal-loop,phosphate 380 A . A.A2062 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop 381 G ( A.G2063 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 382 A ( A.A2064 0.007 anti,~C3'-endo,BII,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,multiplet,splayed-apart 383 A . A.A2065 0.003 anti,BI,non-pair-contact,ss-non-loop,phosphate,splayed-apart 384 C . A.C2066 0.004 syn,~C3'-endo,BI,non-pair-contact,ss-non-loop,phosphate 385 C . A.C2067 0.002 break,anti,~C3'-endo,non-pair-contact,ss-non-loop,phosphate 386 A . A.A2072 0.004 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,phosphate 387 A . A.A2073 0.005 anti,~C3'-endo,non-canonical,non-pair-contact,ss-non-loop,cap-acceptor,phosphate 388 A . A.A2074 0.006 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,cap-donor,phosphate 389 U ) A.U2075 0.005 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,multiplet 390 C ) A.C2076 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 391 C . A.C2077 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 392 C . A.C2078 0.003 anti,~C3'-endo,BII,non-canonical,non-pair-contact,helix,internal-loop 393 C . A.C2079 0.004 syn,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 394 U . A.U2080 0.004 syn,~C3'-endo,non-canonical,non-pair-contact,internal-loop 395 U . A.U2081 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 396 G ) A.G2082 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 397 U ) A.U2083 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 398 A ) A.A2084 0.008 anti,~C2'-endo,BII,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack 399 A ) A.A2085 0.014 anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix-end,stem-end,coaxial-stack 400 A ) A.A2086 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 401 U ) A.U2087 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 402 U ) A.U2088 0.004 anti,~C3'-endo,BI,non-stack,canonical,helix,stem,coaxial-stack 403 U ) A.U2089 0.004 anti,~C3'-endo,BI,non-stack,canonical,helix,stem,coaxial-stack 404 A ) A.A2090 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 405 A ) A.A2091 0.004 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 406 C . A.C2092 0.002 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop 407 U . A.U2093 0.005 anti,~C3'-endo,non-canonical,non-pair-contact,internal-loop 408 G ) A.G2094 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,A-minor,phosphate 409 U ) A.U2095 0.003 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate 410 U . A.U2096 0.006 syn,~C3'-endo,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop 411 A . A.A2097 0.005 turn,anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,splayed-apart 412 G ( A.G2098 0.015 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix-end,stem-end,multiplet,junction-loop,A-minor,splayed-apart 413 U ( A.U2099 0.005 anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem,multiplet 414 C ( A.C2100 0.013 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 415 C ( A.C2101 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 416 A ( A.A2102 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 417 A ( A.A2103 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 418 A ( A.A2104 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 419 G ( A.G2105 0.010 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,multiplet,A-minor,phosphate 420 A ( A.A2106 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,A-minor 421 G ( A.G2107 0.012 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,multiplet,hairpin-loop,phosphate 422 G . A.G2108 0.007 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,phosphate 423 A . A.A2109 0.006 turn,syn,~C2'-endo,non-pair-contact,hairpin-loop,cap-acceptor,phosphate,splayed-apart 424 A . A.A2110 0.002 turn,anti,~C3'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart 425 C . A.C2111 0.012 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,ribose-zipper,phosphate,splayed-apart 426 A . A.A2112 0.005 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,A-minor,ribose-zipper,cap-acceptor,phosphate,splayed-apart 427 G . A.G2113 0.006 turn,anti,~C2'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart 428 C ) A.C2114 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,multiplet,hairpin-loop,cap-donor,phosphate,splayed-apart 429 U ) A.U2115 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,A-minor,phosphate 430 C ) A.C2116 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,multiplet,A-minor,ribose-zipper 431 U ) A.U2117 0.005 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,ribose-zipper,cap-donor 432 U ) A.U2118 0.004 anti,~C3'-endo,BI,non-stack,canonical,helix,stem 433 U ) A.U2119 0.005 anti,~C3'-endo,BI,non-stack,canonical,helix,stem 434 G ) A.G2120 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 435 G ) A.G2121 0.012 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,phosphate 436 A ) A.A2122 0.003 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,multiplet,phosphate 437 C ) A.C2123 0.018 anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix-end,stem-end,multiplet,junction-loop,A-minor 438 A . A.A2124 0.007 turn,anti,~C3'-endo,non-pair-contact,junction-loop 439 C ( A.C2125 0.003 anti,isolated-canonical,non-pair-contact,internal-loop,junction-loop,phosphate 440 U . A.U2126 0.003 anti,~C3'-endo,BI,non-stack,non-pair-contact,internal-loop,phosphate 441 A ( A.A2127 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,multiplet,internal-loop,A-minor 442 G ( A.G2128 0.008 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,multiplet,A-minor 443 G ( A.G2129 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop 444 A . A.A2130 0.009 anti,~C3'-endo,non-pair-contact,hairpin-loop,splayed-apart 445 A . A.A2131 0.004 anti,~C2'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor,cap-donor,phosphate,splayed-apart 446 A . A.A2132 0.007 anti,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor,cap-acceptor 447 A . A.A2133 0.005 syn,~C2'-endo,non-pair-contact,hairpin-loop,splayed-apart 448 A . A.A2134 0.006 anti,~C2'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor,phosphate,splayed-apart 449 A . A.A2135 0.006 syn,~C2'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,phosphate,splayed-apart 450 C ) A.C2136 0.005 anti,~C3'-endo,BI,non-stack,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop,phosphate,splayed-apart 451 C ) A.C2137 0.017 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,multiplet,A-minor,ribose-zipper,phosphate 452 U ) A.U2138 0.003 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix-end,stem-end,multiplet,internal-loop,A-minor,ribose-zipper 453 U . A.U2139 0.010 anti,~C3'-endo,BI,non-pair-contact,internal-loop,phosphate 454 G ) A.G2140 0.005 anti,~C3'-endo,isolated-canonical,non-pair-contact,internal-loop,junction-loop,phosphate 455 U . A.U2141 0.004 ~C2'-endo,non-stack,non-pair-contact,junction-loop,cap-donor,phosphate 456 A . A.A2142 0.003 anti,~C2'-endo,non-stack,non-pair-contact,junction-loop,cap-acceptor,phosphate,splayed-apart 457 G ( A.G2143 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,junction-loop,phosphate,splayed-apart 458 A ( A.A2144 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 459 G ( A.G2145 0.007 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,phosphate,splayed-apart 460 A . A.A2146 0.002 turn,anti,~C2'-endo,non-stack,non-pair-contact,bulge,phosphate,splayed-apart 461 G ( A.G2147 0.002 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,phosphate,splayed-apart 462 A ( A.A2148 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 463 G ( A.G2149 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 464 U . A.U2150 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 465 A . A.A2151 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,internal-loop,A-minor,ribose-zipper,phosphate 466 A . A.A2152 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,internal-loop,A-minor,ribose-zipper,phosphate 467 A ( A.A2153 0.005 anti,~C3'-endo,isolated-canonical,non-pair-contact,helix-end,internal-loop,phosphate 468 A . A.A2154 0.011 anti,~C2'-endo,ss-non-loop,phosphate,splayed-apart 469 A . A.A2155 0.006 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,splayed-apart 470 A . A.A2156 0.004 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop 471 U . A.U2157 0.009 anti,~C3'-endo,non-pair-contact,ss-non-loop,phosphate 472 U . A.U2158 0.004 syn,~C2'-endo,non-stack,non-pair-contact,ss-non-loop,phosphate 473 U . A.U2159 0.004 anti,~C3'-endo,non-stack,non-pair-contact,ss-non-loop,phosphate 474 A . A.A2160 0.002 ~C2'-endo,non-stack,ss-non-loop,phosphate,splayed-apart 475 A . A.A2161 0.005 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,splayed-apart 476 C . A.C2162 0.002 anti,~C3'-endo,non-pair-contact,ss-non-loop,phosphate 477 A . A.A2163 0.006 anti,~C3'-endo,non-pair-contact,ss-non-loop 478 C . A.C2164 0.003 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop 479 C . A.C2165 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop 480 C . A.C2166 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,ss-non-loop,phosphate 481 A . A.A2167 0.003 anti,~C3'-endo,BII,non-canonical,non-pair-contact,helix,ss-non-loop,splayed-apart 482 U ( A.U2168 0.006 anti,~C3'-endo,isolated-canonical,non-pair-contact,helix-end,internal-loop,splayed-apart 483 A . A.A2169 0.006 anti,~C3'-endo,non-pair-contact,internal-loop 484 G ( A.G2170 0.014 turn,anti,~C3'-endo,isolated-canonical,non-pair-contact,helix-end,internal-loop,phosphate 485 U . A.U2171 0.009 syn,~C2'-endo,non-pair-contact,internal-loop,phosphate,splayed-apart 486 A . A.A2172 0.003 turn,anti,~C2'-endo,non-pair-contact,internal-loop,phosphate,splayed-apart 487 G ( A.G2173 0.008 anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,internal-loop,phosphate,splayed-apart 488 G ( A.G2174 0.005 anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem 489 C ( A.C2175 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop,phosphate 490 C . A.C2176 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop 491 U . A.U2177 0.003 u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor 492 A . A.A2178 0.004 turn,u-turn,anti,~C3'-endo,non-pair-contact,hairpin-loop 493 A . A.A2179 0.002 u-turn,anti,~C3'-endo,non-pair-contact,hairpin-loop,cap-donor,phosphate 494 A . A.A2180 0.005 u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate,splayed-apart 495 A . A.A2181 0.003 anti,~C2'-endo,non-pair-contact,hairpin-loop,cap-acceptor,splayed-apart 496 G . A.G2182 0.021 turn,anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,phosphate,splayed-apart 497 C . A.C2183 0.004 anti,~C3'-endo,BII,non-canonical,non-pair-contact,multiplet,hairpin-loop,phosphate,splayed-apart 498 A . A.A2184 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop,splayed-apart 499 G ) A.G2185 0.024 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop 500 C ) A.C2186 0.008 anti,~C3'-endo,canonical,non-pair-contact,helix,stem 501 C ) A.C2187 0.023 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix-end,stem-end,internal-loop,phosphate 502 A . A.A2188 0.003 anti,~C3'-endo,BI,non-pair-contact,internal-loop,phosphate 503 C . A.C2189 0.002 anti,~C3'-endo,non-pair-contact,internal-loop,splayed-apart 504 C ) A.C2190 0.018 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix-end,internal-loop,splayed-apart 505 A . A.A2191 0.006 anti,~C3'-endo,non-pair-contact,internal-loop,phosphate 506 A ) A.A2192 0.004 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix-end,internal-loop 507 U . A.U2193 0.008 anti,~C3'-endo,non-pair-contact,ss-non-loop,phosphate 508 U . A.U2194 0.006 turn,anti,~C2'-endo,BI,non-pair-contact,ss-non-loop,phosphate 509 A . A.A2195 0.007 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop 510 A . A.A2196 0.004 syn,BII,non-pair-contact,ss-non-loop,splayed-apart 511 G ( A.G2197 0.006 anti,~C3'-endo,isolated-canonical,non-pair-contact,helix,bulge,phosphate,splayed-apart 512 A . A.A2198 0.004 turn,~C2'-endo,non-pair-contact,bulge,phosphate,splayed-apart 513 A . A.A2199 0.002 anti,~C2'-endo,BII,non-canonical,non-pair-contact,multiplet,bulge,phosphate,splayed-apart 514 A ( A.A2200 0.003 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,multiplet,bulge 515 G ( A.G2201 0.007 anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem,multiplet 516 C ( A.C2202 0.006 anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,multiplet,hairpin-loop 517 G . A.G2203 0.002 anti,~C3'-endo,non-canonical,non-pair-contact,helix,hairpin-loop 518 U . A.U2204 0.003 u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor 519 U . A.U2205 0.007 turn,u-turn,anti,~C3'-endo,non-pair-contact,hairpin-loop 520 C . A.C2206 0.002 u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-donor,phosphate 521 A . A.A2207 0.003 u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-donor,cap-acceptor,phosphate 522 A . A.A2208 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop,cap-donor 523 G ) A.G2209 0.005 anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,multiplet,hairpin-loop 524 C ) A.C2210 0.005 anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem,multiplet,phosphate 525 U ) A.U2211 0.005 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,multiplet,bulge 526 C ) A.C2212 0.009 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,bulge,phosphate 527 A . A.A2213 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,ss-non-loop,cap-acceptor 528 A . A.A2214 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,ss-non-loop,cap-donor 529 C . A.C2215 0.005 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop 530 A . A.A2216 0.004 anti,~C3'-endo,non-pair-contact,ss-non-loop 531 C . A.C2217 0.002 anti,~C3'-endo,non-pair-contact,ss-non-loop,phosphate 532 C . A.C2218 0.004 break,anti,~C3'-endo,non-pair-contact,ss-non-loop,phosphate 533 A . A.A2228 0.002 anti,~C3'-endo,non-pair-contact,ss-non-loop,A-minor 534 A . A.A2229 0.005 anti,non-canonical,non-pair-contact,multiplet,ss-non-loop,A-minor,phosphate 535 A . A.A2230 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,ss-non-loop,A-minor,phosphate 536 A . A.A2231 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,ss-non-loop,A-minor 537 A . A.A2232 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,ss-non-loop,A-minor,cap-acceptor,phosphate,splayed-apart 538 U . A.U2233 0.002 anti,~C2'-endo,non-pair-contact,ss-non-loop,cap-acceptor,phosphate,splayed-apart 539 C . A.C2234 0.003 anti,~C2'-endo,non-pair-contact,ss-non-loop,phosphate 540 C . A.C2235 0.003 syn,~C3'-endo,BI,non-pair-contact,ss-non-loop,phosphate 541 C . A.C2236 0.008 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,phosphate,splayed-apart 542 A . A.A2237 0.003 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,phosphate,splayed-apart 543 A . A.A2238 0.005 anti,~C3'-endo,non-pair-contact,ss-non-loop 544 A . A.A2239 0.004 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,phosphate 545 C . A.C2240 0.002 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,phosphate,splayed-apart 546 A . A.A2241 0.002 syn,~C3'-endo,ss-non-loop,phosphate,splayed-apart 547 U . A.U2242 0.005 anti,non-stack,non-pair-contact,ss-non-loop,phosphate 548 A . A.A2243 0.004 syn,~C3'-endo,non-pair-contact,ss-non-loop,splayed-apart 549 U . A.U2244 0.005 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,phosphate,splayed-apart 550 A . A.A2245 0.013 ~C2'-endo,non-pair-contact,ss-non-loop,splayed-apart 551 A . A.A2246 0.004 anti,~C3'-endo,non-pair-contact,ss-non-loop 552 C . A.C2247 0.005 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,phosphate 553 U ) A.U2248 0.006 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix-end,internal-loop,phosphate 554 G . A.G2249 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,internal-loop 555 A . A.A2250 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,A-minor,phosphate,splayed-apart 556 A . A.A2251 0.006 turn,syn,~C2'-endo,non-pair-contact,internal-loop,phosphate,splayed-apart 557 C ) A.C2252 0.010 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate,splayed-apart 558 U ) A.U2253 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 559 C ) A.C2254 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 560 C ) A.C2255 0.007 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,phosphate 561 U ) A.U2256 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 562 C ) A.C2257 0.015 anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,junction-loop,phosphate 563 A . A.A2258 0.011 anti,~C3'-endo,non-pair-contact,junction-loop 564 C . A.C2259 0.003 anti,~C3'-endo,BI,non-pair-contact,junction-loop,splayed-apart 565 A . A.A2260 0.003 turn,anti,~C3'-endo,BI,non-pair-contact,junction-loop,splayed-apart 566 C . A.C2261 0.005 anti,BII,non-pair-contact,junction-loop,phosphate,splayed-apart 567 C . A.C2262 0.005 anti,~C2'-endo,BII,non-pair-contact,junction-loop,phosphate,splayed-apart 568 C . A.C2263 0.005 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,junction-loop,splayed-apart 569 A . A.A2264 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,junction-loop,phosphate 570 A . A.A2265 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop,A-minor,phosphate 571 U ) A.U2266 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate 572 U ) A.U2267 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 573 G ) A.G2268 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 574 G ) A.G2269 0.004 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 575 A ) A.A2270 0.002 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 576 C ) A.C2271 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 577 C . A.C2272 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop 578 A . A.A2273 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop 579 A . A.A2274 0.004 syn,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop,phosphate 580 U ( A.U2275 0.006 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate 581 C ( A.C2276 0.008 anti,~C3'-endo,BI,non-stack,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet 582 U ( A.U2277 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 583 A ( A.A2278 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 584 U ( A.U2279 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,phosphate 585 C . A.C2280 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop 586 A . A.A2281 0.005 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 587 C . A.C2282 0.003 syn,~C2'-endo,non-pair-contact,hairpin-loop,splayed-apart 588 C . A.C2283 0.003 turn,anti,~C2'-endo,non-stack,non-pair-contact,hairpin-loop,phosphate,splayed-apart 589 C . A.C2284 0.004 syn,~C2'-endo,non-stack,hairpin-loop,phosphate 590 U . A.U2285 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop 591 A ) A.A2286 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,phosphate 592 U ) A.U2287 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 593 A ) A.A2288 0.003 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 594 G ) A.G2289 0.010 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,phosphate 595 A ) A.A2290 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 596 A . A.A2291 0.004 anti,~C2'-endo,non-canonical,non-pair-contact,helix,junction-loop,phosphate,splayed-apart 597 G . A.G2292 0.003 turn,anti,~C2'-endo,non-stack,non-pair-contact,junction-loop,splayed-apart 598 A . A.A2293 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop,splayed-apart 599 A . A.A2294 0.004 anti,~C2'-endo,non-canonical,non-pair-contact,helix,junction-loop,cap-acceptor,phosphate,splayed-apart 600 C . A.C2295 0.005 syn,~C2'-endo,BII,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,splayed-apart 601 U . A.U2296 0.005 turn,anti,~C3'-endo,non-pair-contact,junction-loop,cap-donor,splayed-apart 602 A . A.A2297 0.010 anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,A-minor,cap-acceptor,phosphate,splayed-apart 603 A . A.A2298 0.002 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,junction-loop,A-minor,phosphate,splayed-apart 604 U . A.U2299 0.003 turn,anti,~C3'-endo,non-pair-contact,junction-loop,splayed-apart 605 G ) A.G2300 0.013 anti,~C3'-endo,isolated-canonical,non-canonical,non-pair-contact,helix,bulge,junction-loop,splayed-apart 606 U ) A.U2301 0.011 anti,~C3'-endo,BI,isolated-canonical,non-canonical,non-pair-contact,helix,bulge,phosphate 607 U . A.U2302 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,bulge 608 A ) A.A2303 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,A-minor 609 G ) A.G2304 0.006 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,phosphate 610 U ) A.U2305 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,phosphate 611 A ( A.A2306 0.007 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,internal-loop,phosphate 612 U . A.U2307 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 613 A . A.A2308 0.010 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate 614 A . A.A2309 0.011 anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,internal-loop,phosphate 615 G . A.G2310 0.011 turn,anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,internal-loop,phosphate 616 U . A.U2311 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate 617 A . A.A2312 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 618 A ( A.A2313 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 619 C ( A.C2314 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 620 A . A.A2315 0.006 syn,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,junction-loop 621 U . A.U2316 0.006 anti,~C2'-endo,non-stack,junction-loop,splayed-apart 622 G ( A.G2317 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,cap-donor,phosphate,splayed-apart 623 A ( A.A2318 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 624 A ( A.A2319 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop 625 A . A.A2320 0.003 anti,~C3'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart 626 A . A.A2321 0.017 turn,syn,~C2'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart 627 C . A.C2322 0.006 turn,~C2'-endo,non-pair-contact,hairpin-loop,phosphate 628 A . A.A2323 0.002 turn,syn,~C3'-endo,non-pair-contact,hairpin-loop 629 U ) A.U2324 0.003 anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop,phosphate 630 U ) A.U2325 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 631 C ) A.C2326 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate 632 U ( A.U2327 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate 633 C ( A.C2328 0.003 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,phosphate 634 C ( A.C2329 0.003 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 635 U . A.U2330 0.002 anti,~C3'-endo,BII,non-canonical,non-pair-contact,helix-end,internal-loop,splayed-apart 636 C . A.C2331 0.006 turn,anti,~C2'-endo,non-stack,non-pair-contact,internal-loop,splayed-apart 637 C . A.C2332 0.003 anti,~C3'-endo,BI,non-stack,non-pair-contact,internal-loop,phosphate,splayed-apart 638 G ( A.G2333 0.017 anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,internal-loop 639 C ( A.C2334 0.006 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,phosphate 640 A ( A.A2335 0.004 anti,~C3'-endo,canonical,non-pair-contact,helix,stem 641 U ( A.U2336 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,junction-loop 642 A . A.A2337 0.005 anti,~C3'-endo,BI,non-pair-contact,junction-loop 643 A . A.A2338 0.003 anti,~C3'-endo,BI,non-pair-contact,junction-loop,phosphate 644 G . A.G2339 0.004 anti,~C3'-endo,BI,non-pair-contact,junction-loop,phosphate 645 C . A.C2340 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,junction-loop,phosphate 646 C . A.C2341 0.011 anti,~C2'-endo,BII,non-pair-contact,junction-loop 647 U . A.U2342 0.002 turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,junction-loop,cap-donor,phosphate 648 G ( A.G2343 0.004 syn,~C3'-endo,isolated-canonical,non-pair-contact,helix,junction-loop,cap-acceptor,splayed-apart 649 C . A.C2344 0.004 turn,anti,~C3'-endo,non-pair-contact,junction-loop,phosphate,splayed-apart 650 G ( A.G2345 0.006 anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,junction-loop,phosphate,splayed-apart 651 U ( A.U2346 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 652 C ( A.C2347 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 653 A ( A.A2348 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 654 G ( A.G2349 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end 655 A . A.A2350 0.003 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop 656 U . A.U2351 0.003 break,anti,~C3'-endo,non-pair-contact,ss-non-loop 657 C . A.C2357 0.003 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop 658 A . A.A2358 0.002 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop 659 C . A.C2359 0.003 break,anti,~C3'-endo,non-pair-contact,ss-non-loop 660 A . A.A2363 0.002 anti,~C2'-endo,non-pair-contact,ss-non-loop,splayed-apart 661 C ) A.C2364 0.011 anti,~C3'-endo,BI,non-stack,canonical,non-pair-contact,helix-end,stem-end,phosphate,splayed-apart 662 U ) A.U2365 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 663 G ) A.G2366 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 664 A ) A.A2367 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 665 C ) A.C2368 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,junction-loop,phosphate 666 A . A.A2369 0.005 anti,~C3'-endo,non-pair-contact,junction-loop,phosphate 667 A . A.A2370 0.004 anti,~C2'-endo,non-pair-contact,junction-loop,phosphate 668 U . A.U2371 0.010 anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,junction-loop,cap-acceptor,phosphate,splayed-apart 669 U . A.U2372 0.005 syn,~C2'-endo,non-pair-contact,junction-loop,cap-donor,phosphate,splayed-apart 670 A . A.A2373 0.005 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix-end,junction-loop,phosphate,splayed-apart 671 A . A.A2374 0.003 turn,anti,~C2'-endo,non-pair-contact,junction-loop,phosphate,splayed-apart 672 C ( A.C2375 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop,phosphate,splayed-apart 673 A ( A.A2376 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 674 G ( A.G2377 0.009 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,internal-loop 675 C . A.C2378 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,internal-loop,phosphate 676 C . A.C2379 0.002 syn,~C3'-endo,BI,non-pair-contact,internal-loop 677 C . A.C2380 0.003 anti,~C3'-endo,non-pair-contact,internal-loop,splayed-apart 678 A ( A.A2381 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,internal-loop,phosphate,splayed-apart 679 A ( A.A2382 0.004 anti,~C3'-endo,canonical,non-pair-contact,helix,stem 680 U ( A.U2383 0.004 anti,~C3'-endo,canonical,non-pair-contact,helix,stem 681 A ( A.A2384 0.003 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,internal-loop 682 U . A.U2385 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop 683 C . A.C2386 0.004 anti,~C3'-endo,non-pair-contact,internal-loop 684 U . A.U2387 0.003 anti,~C3'-endo,non-pair-contact,internal-loop,splayed-apart 685 A . A.A2388 0.003 anti,~C3'-endo,non-pair-contact,internal-loop,splayed-apart 686 C . A.C2389 0.007 anti,~C2'-endo,non-pair-contact,internal-loop,splayed-apart 687 A . A.A2390 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop,phosphate,splayed-apart 688 A . A.A2391 0.004 anti,~C3'-endo,BI,non-pair-contact,internal-loop,phosphate 689 U . A.U2392 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,internal-loop,splayed-apart 690 C . A.C2393 0.002 turn,anti,~C2'-endo,non-stack,non-pair-contact,internal-loop,phosphate,splayed-apart 691 A . A.A2394 0.005 anti,~C2'-endo,non-pair-contact,internal-loop 692 A . A.A2395 0.004 anti,~C3'-endo,non-pair-contact,internal-loop,phosphate 693 C . A.C2396 0.005 anti,~C3'-endo,BI,non-pair-contact,internal-loop 694 C . A.C2397 0.005 anti,~C3'-endo,non-canonical,non-pair-contact,internal-loop 695 A . A.A2398 0.002 anti,~C3'-endo,non-pair-contact,internal-loop 696 A . A.A2399 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop 697 C ( A.C2400 0.008 anti,~C2'-endo,isolated-canonical,non-pair-contact,helix-end,hairpin-loop,internal-loop 698 A . A.A2401 0.003 turn,anti,~C2'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart 699 A . A.A2402 0.005 anti,~C2'-endo,non-pair-contact,hairpin-loop,cap-donor,phosphate,splayed-apart 700 G ) A.G2403 0.007 anti,~C2'-endo,isolated-canonical,non-pair-contact,helix-end,hairpin-loop,internal-loop,cap-acceptor,phosphate 701 U . A.U2404 0.005 anti,BI,non-stack,non-pair-contact,internal-loop,cap-donor 702 C . A.C2405 0.006 non-stack,non-pair-contact,internal-loop,cap-acceptor,splayed-apart 703 A . A.A2406 0.005 anti,~C2'-endo,non-pair-contact,internal-loop,splayed-apart 704 U . A.U2407 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop 705 U ) A.U2408 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop 706 A ) A.A2409 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 707 U ) A.U2410 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 708 U ) A.U2411 0.005 anti,~C3'-endo,BI,non-stack,canonical,helix-end,stem-end,internal-loop 709 A . A.A2412 0.005 anti,~C3'-endo,non-pair-contact,internal-loop 710 C . A.C2413 0.004 anti,~C3'-endo,non-pair-contact,internal-loop 711 C . A.C2414 0.005 anti,~C3'-endo,non-pair-contact,internal-loop,phosphate 712 C . A.C2415 0.007 syn,~C3'-endo,BI,non-stack,non-pair-contact,internal-loop 713 U . A.U2416 0.004 anti,~C3'-endo,BI,non-stack,non-pair-contact,internal-loop,phosphate 714 C . A.C2417 0.002 syn,non-stack,non-pair-contact,internal-loop,splayed-apart 715 A . A.A2418 0.005 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,internal-loop,splayed-apart 716 C ) A.C2419 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop,phosphate 717 U ) A.U2420 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 718 G ) A.G2421 0.005 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,junction-loop,phosphate 719 U . A.U2422 0.010 anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,junction-loop,cap-acceptor,phosphate,splayed-apart 720 C ) A.C2423 0.003 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,junction-loop,cap-donor,phosphate,splayed-apart 721 A . A.A2424 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,junction-loop,splayed-apart 722 A . A.A2425 0.005 turn,anti,~C2'-endo,non-pair-contact,junction-loop,phosphate,splayed-apart 723 C . A.C2426 0.005 anti,~C2'-endo,non-pair-contact,junction-loop,splayed-apart 724 C ( A.C2427 0.008 anti,~C3'-endo,non-stack,canonical,non-pair-contact,helix-end,stem-end,junction-loop,splayed-apart 725 C ( A.C2428 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop 726 A . A.A2429 0.002 anti,~C3'-endo,non-pair-contact,hairpin-loop,splayed-apart 727 A . A.A2430 0.002 turn,anti,~C3'-endo,BI,non-stack,non-pair-contact,hairpin-loop,phosphate,splayed-apart 728 C . A.C2431 0.004 anti,~C2'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart 729 A . A.A2432 0.008 turn,anti,~C2'-endo,non-pair-contact,hairpin-loop,splayed-apart 730 C . A.C2433 0.004 anti,~C2'-endo,non-pair-contact,hairpin-loop,splayed-apart 731 A . A.A2434 0.013 turn,anti,~C2'-endo,BI,non-pair-contact,hairpin-loop,splayed-apart 732 G ) A.G2435 0.005 anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop,splayed-apart 733 G ) A.G2436 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,junction-loop 734 C . A.C2437 0.002 anti,~C3'-endo,non-pair-contact,junction-loop 735 A ) A.A2438 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,junction-loop 736 U ) A.U2439 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 737 G ) A.G2440 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 738 C ) A.C2441 0.016 anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,internal-loop 739 U . A.U2442 0.002 anti,~C3'-endo,non-pair-contact,internal-loop,phosphate 740 C . A.C2443 0.006 turn,syn,~C2'-endo,non-pair-contact,internal-loop,cap-donor,phosphate 741 A . A.A2444 0.003 turn,~C2'-endo,non-pair-contact,internal-loop,cap-donor,cap-acceptor,phosphate 742 U . A.U2445 0.003 syn,~C3'-endo,non-pair-contact,internal-loop,phosphate,splayed-apart 743 A . A.A2446 0.002 turn,anti,~C2'-endo,non-pair-contact,internal-loop,splayed-apart 744 A . A.A2447 0.003 syn,~C3'-endo,non-canonical,non-pair-contact,helix-end,internal-loop,phosphate,splayed-apart 745 G ) A.G2448 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 746 G ) A.G2449 0.006 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,phosphate 747 A ) A.A2450 0.005 anti,~C2'-endo,BII,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 748 A . A.A2451 0.004 turn,anti,~C3'-endo,non-stack,non-canonical,multiplet,junction-loop,A-minor,phosphate 749 A . A.A2452 0.003 anti,~C3'-endo,non-stack,non-pair-contact,junction-loop,cap-acceptor,phosphate,splayed-apart 750 G ( A.G2453 0.003 turn,anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,splayed-apart 751 G ( A.G2454 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 752 U ( A.U2455 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 753 U ( A.U2456 0.004 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 754 A . A.A2457 0.004 anti,non-pair-contact,internal-loop,phosphate,splayed-apart 755 A . A.A2458 0.002 anti,~C3'-endo,BI,non-pair-contact,internal-loop,cap-acceptor,phosphate,splayed-apart 756 A . A.A2459 0.005 anti,~C3'-endo,BI,non-pair-contact,internal-loop 757 A . A.A2460 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 758 A ( A.A2461 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 759 A ( A.A2462 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 760 A ( A.A2463 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 761 G ( A.G2464 0.013 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack 762 U ( A.U2465 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 763 A ( A.A2466 0.019 anti,~C3'-endo,isolated-canonical,non-canonical,non-pair-contact,helix-end,bulge,internal-loop,phosphate 764 A . A.A2467 0.007 anti,~C3'-endo,BI,non-pair-contact,internal-loop 765 A . A.A2468 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,multiplet,internal-loop,phosphate 766 A ( A.A2469 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 767 G ( A.G2470 0.008 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,phosphate 768 G . A.G2471 0.005 anti,non-canonical,non-pair-contact,multiplet,bulge,phosphate 769 A . A.A2472 0.003 turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,bulge,cap-donor,phosphate 770 A ( A.A2473 0.002 turn,~C3'-endo,isolated-canonical,non-pair-contact,helix,multiplet,bulge,internal-loop,cap-acceptor,phosphate 771 C . A.C2474 0.002 anti,~C3'-endo,non-pair-contact,internal-loop,phosphate 772 U . A.U2475 0.004 u-turn,anti,~C3'-endo,BI,non-pair-contact,internal-loop,cap-acceptor 773 C . A.C2476 0.007 turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,internal-loop,cap-acceptor 774 G . A.G2477 0.002 u-turn,anti,~C3'-endo,BI,non-pair-contact,internal-loop,cap-donor,phosphate,splayed-apart 775 G ( A.G2478 0.005 turn,u-turn,anti,BII,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,internal-loop,A-minor,phosphate,splayed-apart 776 C . A.C2479 0.004 turn,anti,~C3'-endo,BI,non-pair-contact,internal-loop 777 A . A.A2480 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,internal-loop,phosphate 778 A . A.A2481 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,internal-loop,A-minor 779 A . A.A2482 0.004 anti,~C2'-endo,BI,non-canonical,non-pair-contact,multiplet,internal-loop,A-minor 780 U . A.U2483 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate 781 C . A.C2484 0.004 syn,non-pair-contact,internal-loop,phosphate 782 U . A.U2485 0.004 anti,~C3'-endo,BI,non-pair-contact,internal-loop 783 U . A.U2486 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 784 A ( A.A2487 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 785 C ( A.C2488 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 786 C ( A.C2489 0.007 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 787 C ( A.C2490 0.005 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 788 C ( A.C2491 0.014 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 789 G ( A.G2492 0.011 anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,junction-loop,cap-acceptor 790 C . A.C2493 0.006 syn,~C3'-endo,BI,non-pair-contact,junction-loop,cap-donor,cap-acceptor,phosphate 791 C ] A.C2494 0.016 pseudoknotted,anti,~C3'-endo,isolated-canonical,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,cap-donor,phosphate 792 U . A.U2495 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,junction-loop,phosphate 793 G ( A.G2496 0.005 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,multiplet,junction-loop,A-minor,phosphate 794 U ( A.U2497 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop 795 U . A.U2498 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop 796 U . A.U2499 0.015 syn,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate,splayed-apart 797 A . A.A2500 0.006 turn,anti,~C2'-endo,non-stack,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate,splayed-apart 798 C . A.C2501 0.005 anti,~C2'-endo,non-pair-contact,hairpin-loop,cap-donor,splayed-apart 799 C . A.C2502 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,ribose-zipper,cap-donor,splayed-apart 800 A . A.A2503 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop,ribose-zipper,phosphate 801 A . A.A2504 0.003 turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate 802 A . A.A2505 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop,A-minor,splayed-apart 803 A . A.A2506 0.005 turn,anti,non-pair-contact,hairpin-loop,phosphate,splayed-apart 804 A ) A.A2507 0.016 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,hairpin-loop,phosphate,splayed-apart 805 C ) A.C2508 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,multiplet,junction-loop,A-minor,phosphate 806 A . A.A2509 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,junction-loop,phosphate 807 U . A.U2510 0.002 anti,~C3'-endo,BII,non-canonical,non-pair-contact,multiplet,junction-loop,phosphate 808 C . A.C2511 0.009 syn,~C3'-endo,non-canonical,non-pair-contact,helix-end,junction-loop,phosphate 809 A . A.A2512 0.005 anti,~C3'-endo,non-canonical,non-pair-contact,helix,junction-loop,phosphate 810 C ( A.C2513 0.013 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,multiplet,junction-loop,A-minor 811 C ( A.C2514 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 812 U ( A.U2515 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 813 C ( A.C2516 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 814 U ( A.U2517 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 815 A ( A.A2518 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop,phosphate 816 G . A.G2519 0.004 turn,anti,~C2'-endo,non-pair-contact,hairpin-loop 817 C . A.C2520 0.005 anti,~C2'-endo,BII,non-stack,non-canonical,multiplet,hairpin-loop,phosphate 818 A . A.A2521 0.003 anti,~C3'-endo,non-pair-contact,hairpin-loop,phosphate 819 U . A.U2522 0.006 syn,~C3'-endo,BI,non-stack,non-pair-contact,hairpin-loop,splayed-apart 820 C . A.C2523 0.005 anti,~C2'-endo,BII,non-pair-contact,hairpin-loop,phosphate,splayed-apart 821 A . A.A2524 0.005 anti,~C3'-endo,non-pair-contact,hairpin-loop,splayed-apart 822 C . A.C2525 0.007 turn,anti,~C3'-endo,non-pair-contact,hairpin-loop,phosphate 823 C . A.C2526 0.004 anti,~C2'-endo,non-pair-contact,hairpin-loop,phosphate 824 A . A.A2527 0.004 turn,anti,~C3'-endo,non-stack,non-pair-contact,hairpin-loop,phosphate,splayed-apart 825 G . A.G2528 0.009 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,phosphate,splayed-apart 826 U . A.U2529 0.005 anti,~C2'-endo,non-canonical,non-pair-contact,hairpin-loop,phosphate 827 A . A.A2530 0.003 anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,cap-donor,phosphate,splayed-apart 828 U . A.U2531 0.003 turn,anti,~C2'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart 829 U ) A.U2532 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop,cap-acceptor,phosphate,splayed-apart 830 A ) A.A2533 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 831 G ) A.G2534 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 832 A ) A.A2535 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 833 G ) A.G2536 0.010 anti,~C3'-endo,canonical,non-pair-contact,helix,stem 834 G ) A.G2537 0.009 anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,multiplet,junction-loop,A-minor,phosphate 835 C . A.C2538 0.015 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop,phosphate 836 A . A.A2539 0.003 anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix-end,junction-loop,splayed-apart 837 C . A.C2540 0.007 anti,~C3'-endo,non-pair-contact,junction-loop,splayed-apart 838 C . A.C2541 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,junction-loop,phosphate 839 G ( A.G2542 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop 840 C ( A.C2543 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 841 C ( A.C2544 0.014 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,multiplet,junction-loop,A-minor 842 U . A.U2545 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,splayed-apart 843 G ( A.G2546 0.012 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,splayed-apart 844 C ( A.C2547 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 845 C ( A.C2548 0.014 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,A-minor 846 C . A.C2549 0.002 turn,anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,bulge 847 A . A.A2550 0.008 turn,anti,~C3'-endo,BI,non-pair-contact,bulge 848 G ( A.G2551 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge 849 U ( A.U2552 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge 850 G ( A.G2553 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 851 A ( A.A2554 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 852 C ( A.C2555 0.003 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 853 A ( A.A2556 0.010 anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop,phosphate 854 C . A.C2557 0.012 turn,syn,~C2'-endo,non-stack,non-pair-contact,hairpin-loop,splayed-apart 855 A . A.A2558 0.001 turn,anti,~C2'-endo,non-stack,non-pair-contact,hairpin-loop,phosphate,splayed-apart 856 U ) A.U2559 0.013 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop,splayed-apart 857 G ) A.G2560 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 858 U ) A.U2561 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 859 U ) A.U2562 0.009 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 860 U . A.U2563 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,bulge,phosphate,splayed-apart 861 A . A.A2564 0.008 turn,anti,~C2'-endo,non-pair-contact,bulge,A-minor,phosphate,splayed-apart 862 A ) A.A2565 0.004 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,phosphate,splayed-apart 863 C ) A.C2566 0.014 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge 864 G ) A.G2567 0.006 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,A-minor 865 G ) A.G2568 0.023 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 866 C ) A.C2569 0.020 anti,~C3'-endo,BII,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,splayed-apart 867 C ( A.C2570 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop,splayed-apart 868 G ( A.G2571 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 869 C ( A.C2572 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 870 G ( A.G2573 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 871 G ( A.G2574 0.004 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end 872 U . A.U2575 0.002 break,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop 873 U . A.U2580 0.003 anti,~C3'-endo,non-pair-contact,ss-non-loop 874 A . A.A2581 0.003 anti,~C3'-endo,non-pair-contact,ss-non-loop 875 A . A.A2582 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop,cap-acceptor,phosphate 876 C ) A.C2583 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,cap-donor 877 C ) A.C2584 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 878 G ) A.G2585 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 879 U ) A.U2586 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 880 G ) A.G2587 0.006 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,junction-loop 881 C . A.C2588 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop 882 A . A.A2589 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,splayed-apart 883 A . A.A2590 0.005 turn,anti,~C2'-endo,BI,non-canonical,non-pair-contact,multiplet,junction-loop,A-minor,splayed-apart 884 A . A.A2591 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,A-minor 885 G . A.G2592 0.003 syn,~C2'-endo,non-canonical,non-pair-contact,helix,junction-loop,splayed-apart 886 G . A.G2593 0.007 anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,splayed-apart 887 U . A.U2594 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,junction-loop,phosphate 888 A . A.A2595 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop 889 G ( A.G2596 0.019 anti,~C3'-endo,isolated-canonical,non-pair-contact,helix,bulge,junction-loop 890 C ( A.C2597 0.004 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,bulge,internal-loop 891 A . A.A2598 0.002 anti,~C3'-endo,non-pair-contact,internal-loop,cap-donor 892 U . A.U2599 0.003 turn,syn,~C2'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate 893 A . A.A2600 0.003 anti,~C2'-endo,non-canonical,non-pair-contact,internal-loop,cap-acceptor,splayed-apart 894 A . A.A2601 0.006 turn,anti,~C2'-endo,BI,non-pair-contact,internal-loop,phosphate,splayed-apart 895 U . A.U2602 0.003 anti,~C2'-endo,non-pair-contact,internal-loop,phosphate,splayed-apart 896 C . A.C2603 0.005 anti,~C3'-endo,BI,non-pair-contact,internal-loop,cap-donor,phosphate,splayed-apart 897 A . A.A2604 0.002 anti,~C3'-endo,BI,non-pair-contact,internal-loop,phosphate 898 C . A.C2605 0.003 anti,~C3'-endo,non-pair-contact,internal-loop,phosphate 899 U . A.U2606 0.017 anti,~C2'-endo,non-pair-contact,internal-loop,splayed-apart 900 U . A.U2607 0.003 turn,anti,~C2'-endo,non-stack,non-pair-contact,internal-loop,splayed-apart 901 G ( A.G2608 0.011 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,splayed-apart 902 U ( A.U2609 0.007 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 903 U ( A.U2610 0.013 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 904 C ( A.C2611 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 905 C ( A.C2612 0.004 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop 906 U . A.U2613 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,A-minor 907 U . A.U2614 0.008 u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-acceptor 908 A . A.A2615 0.007 turn,u-turn,anti,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor,ribose-zipper,phosphate 909 A . A.A2616 0.007 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor,ribose-zipper,cap-donor,cap-acceptor,phosphate 910 A . A.A2617 0.004 u-turn,anti,~C2'-endo,non-pair-contact,hairpin-loop,A-minor,phosphate,splayed-apart 911 U . A.U2618 0.004 turn,anti,~C2'-endo,non-stack,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate,splayed-apart 912 A . A.A2619 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,A-minor,splayed-apart 913 G ) A.G2620 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop 914 G ) A.G2621 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 915 G ) A.G2622 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 916 A ) A.A2623 0.003 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 917 C ) A.C2624 0.017 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 918 C . A.C2625 0.006 anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,splayed-apart 919 U . A.U2626 0.005 turn,anti,~C2'-endo,BII,non-stack,non-pair-contact,internal-loop,splayed-apart 920 G ) A.G2627 0.003 turn,anti,~C3'-endo,isolated-canonical,non-canonical,non-pair-contact,helix,bulge,internal-loop,phosphate,splayed-apart 921 U . A.U2628 0.007 turn,anti,~C2'-endo,non-stack,non-pair-contact,bulge,phosphate,splayed-apart 922 A . A.A2629 0.008 anti,~C2'-endo,BII,non-pair-contact,bulge,A-minor,cap-acceptor,splayed-apart 923 U ) A.U2630 0.009 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,bulge,junction-loop,phosphate,splayed-apart 924 G . A.G2631 0.012 anti,~C3'-endo,non-canonical,non-pair-contact,helix,junction-loop 925 A . A.A2632 0.005 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,junction-loop,A-minor,phosphate,splayed-apart 926 A . A.A2633 0.003 turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,A-minor,phosphate,splayed-apart 927 U . A.U2634 0.003 turn,anti,~C2'-endo,non-stack,non-pair-contact,junction-loop,phosphate,splayed-apart 928 G ) A.G2635 0.011 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,multiplet,junction-loop,A-minor,phosphate,splayed-apart 929 G ) A.G2636 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 930 C ) A.C2637 0.016 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop,phosphate 931 U . A.U2638 0.006 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,junction-loop 932 C . A.C2639 0.003 anti,~C3'-endo,BI,non-pair-contact,junction-loop 933 C . A.C2640 0.003 anti,~C3'-endo,BI,non-pair-contact,junction-loop 934 A . A.A2641 0.003 anti,~C3'-endo,non-pair-contact,junction-loop 935 C ) A.C2642 0.016 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,junction-loop 936 G ) A.G2643 0.012 anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,splayed-apart 937 A . A.A2644 0.005 turn,anti,~C3'-endo,non-stack,non-canonical,non-pair-contact,multiplet,bulge,A-minor,cap-acceptor,splayed-apart 938 G ) A.G2645 0.005 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,phosphate,splayed-apart 939 G ) A.G2646 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 940 G ) A.G2647 0.004 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 941 U ) A.U2648 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 942 U . A.U2649 0.006 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop 943 C . A.C2650 0.003 anti,~C3'-endo,BI,non-pair-contact,internal-loop 944 A . A.A2651 0.003 anti,~C3'-endo,BI,non-pair-contact,internal-loop 945 G . A.G2652 0.008 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 946 C ) A.C2653 0.013 anti,~C3'-endo,isolated-canonical,non-pair-contact,helix,multiplet,internal-loop,A-minor 947 U . A.U2654 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate,splayed-apart 948 G . A.G2655 0.008 turn,anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,internal-loop,phosphate,splayed-apart 949 U ) A.U2656 0.003 turn,anti,~C3'-endo,BI,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,bulge,internal-loop 950 C ) A.C2657 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,phosphate 951 U ) A.U2658 0.003 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 952 C . A.C2659 0.011 anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix-end,multiplet,internal-loop,cap-acceptor 953 U ) A.U2660 0.012 anti,~C3'-endo,isolated-canonical,non-pair-contact,helix-end,bulge,internal-loop 954 U . A.U2661 0.006 anti,~C3'-endo,non-canonical,non-pair-contact,bulge 955 A ) A.A2662 0.009 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,phosphate 956 C ) A.C2663 0.018 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 957 U ) A.U2664 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 958 U ) A.U2665 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 959 U ) A.U2666 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 960 U . A.U2667 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 961 A ) A.A2668 0.004 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 962 A ) A.A2669 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 963 C ) A.C2670 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 964 C ) A.C2671 0.013 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop 965 A . A.A2672 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop 966 G ) A.G2673 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate 967 U ) A.U2674 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 968 G . A.G2675 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 969 A . A.A2676 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate 970 A . A.A2677 0.005 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,cap-donor,phosphate 971 A . A.A2678 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop 972 U . A.U2679 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 973 U ) A.U2680 0.005 anti,~C3'-endo,isolated-canonical,non-pair-contact,helix,internal-loop,cap-acceptor,splayed-apart 974 G ) A.G2681 0.005 turn,anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,cap-donor,splayed-apart 975 A . A.A2682 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,ss-non-loop,cap-acceptor,phosphate 976 C { A.C2683 0.008 pseudoknotted,anti,~C3'-endo,BI,isolated-canonical,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,A-minor,cap-donor,phosphate,splayed-apart 977 C . A.C2684 0.003 turn,syn,~C2'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart 978 U . A.U2685 0.003 anti,~C2'-endo,non-pair-contact,hairpin-loop,splayed-apart 979 G ( A.G2686 0.013 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,hairpin-loop,phosphate,splayed-apart 980 C ( A.C2687 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,hairpin-loop,phosphate 981 C ( A.C2688 0.014 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,hairpin-loop,phosphate 982 C ( A.C2689 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,multiplet,hairpin-loop,A-minor,cap-donor,phosphate 983 G ( A.G2690 0.006 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix-end,stem-end,multiplet,hairpin-loop,A-minor,phosphate 984 U . A.U2691 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,phosphate 985 G . A.G2692 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,hairpin-loop,phosphate,splayed-apart 986 A . A.A2693 0.005 turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-donor,phosphate,splayed-apart 987 A . A.A2694 0.006 anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor,phosphate,splayed-apart 988 G . A.G2695 0.010 anti,~C2'-endo,BII,non-pair-contact,hairpin-loop,phosphate,splayed-apart 989 A ] A.A2696 0.006 pseudoknotted,anti,~C2'-endo,isolated-canonical,non-canonical,non-pair-contact,multiplet,hairpin-loop,phosphate,splayed-apart 990 G } A.G2697 0.012 pseudoknotted,turn,anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,A-minor,phosphate,splayed-apart 991 G . A.G2698 0.006 anti,~C2'-endo,non-canonical,non-pair-contact,helix,hairpin-loop,phosphate,splayed-apart 992 C ) A.C2699 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,multiplet,hairpin-loop,A-minor,cap-donor,splayed-apart 993 G ) A.G2700 0.005 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,multiplet,A-minor 994 G ) A.G2701 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 995 G ) A.G2702 0.015 anti,~C3'-endo,canonical,non-pair-contact,helix,stem 996 C ) A.C2703 0.001 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,phosphate 997 A . A.A2704 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,ss-non-loop 998 U . A.U2705 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop,phosphate,splayed-apart 999 A . A.A2706 0.004 anti,~C3'-endo,non-pair-contact,ss-non-loop,ribose-zipper,phosphate,splayed-apart 1000 A . A.A2707 0.002 anti,~C3'-endo,non-pair-contact,ss-non-loop,ribose-zipper 1001 C . A.C2708 0.002 anti,~C3'-endo,non-pair-contact,ss-non-loop 1002 A . A.A2709 0.005 anti,~C3'-endo,non-pair-contact,ss-non-loop 1003 C . A.C2710 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,ss-non-loop,phosphate 1004 A ( A.A2711 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack 1005 G ( A.G2712 0.011 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 1006 C . A.C2713 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 1007 A . A.A2714 0.006 anti,~C2'-endo,BII,non-canonical,non-pair-contact,multiplet,internal-loop,phosphate 1008 A ( A.A2715 0.003 anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,phosphate 1009 G ( A.G2716 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet 1010 A ( A.A2717 0.003 turn,anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,multiplet,internal-loop,splayed-apart 1011 C . A.C2718 0.003 turn,anti,~C3'-endo,non-stack,non-canonical,non-pair-contact,internal-loop,splayed-apart 1012 G ( A.G2719 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,internal-loop,phosphate,splayed-apart 1013 A ( A.A2720 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,junction-loop,phosphate 1014 G . A.G2721 0.002 anti,~C3'-endo,non-pair-contact,junction-loop 1015 A . A.A2722 0.015 anti,~C3'-endo,non-pair-contact,junction-loop,splayed-apart 1016 A . A.A2723 0.012 turn,anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,splayed-apart 1017 G . A.G2724 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,junction-loop,phosphate,splayed-apart 1018 A . A.A2725 0.002 turn,anti,~C2'-endo,non-stack,junction-loop,phosphate,splayed-apart 1019 C . A.C2726 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,splayed-apart 1020 C ( A.C2727 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop 1021 C ( A.C2728 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,phosphate 1022 U ( A.U2729 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1023 A ( A.A2730 0.003 anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,A-minor,splayed-apart 1024 U . A.U2731 0.005 turn,anti,~C3'-endo,non-stack,non-canonical,non-pair-contact,bulge,cap-donor,cap-acceptor,phosphate,splayed-apart 1025 G ( A.G2732 0.005 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,A-minor,phosphate,splayed-apart 1026 G ( A.G2733 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,phosphate 1027 A ( A.A2734 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge 1028 G ( A.G2735 0.021 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 1029 C ( A.C2736 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 1030 U ( A.U2737 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet 1031 U . A.U2738 0.007 anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,ss-non-loop,splayed-apart 1032 U . A.U2739 0.004 turn,anti,~C2'-endo,non-pair-contact,ss-non-loop,splayed-apart 1033 A ( A.A2740 0.006 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,phosphate,splayed-apart 1034 A ( A.A2741 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1035 U ( A.U2742 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1036 U ( A.U2743 0.003 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1037 U ( A.U2744 0.004 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 1038 A . A.A2745 0.003 turn,anti,BI,non-stack,non-pair-contact,bulge 1039 U ( A.U2746 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 1040 U ( A.U2747 0.004 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 1041 A ( A.A2748 0.012 anti,~C3'-endo,isolated-canonical,non-pair-contact,helix,bulge 1042 A . A.A2749 0.007 anti,~C3'-endo,non-canonical,non-pair-contact,bulge 1043 U ( A.U2750 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 1044 G ( A.G2751 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1045 C ( A.C2752 0.017 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1046 A ( A.A2753 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack 1047 A . A.A2754 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,ss-non-loop 1048 A . A.A2755 0.003 anti,~C3'-endo,non-pair-contact,ss-non-loop 1049 C . A.C2756 0.002 anti,~C3'-endo,non-pair-contact,ss-non-loop,phosphate 1050 A . A.A2757 0.004 anti,~C3'-endo,non-pair-contact,ss-non-loop 1051 G . A.G2758 0.002 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop 1052 U . A.U2759 0.002 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop 1053 A . A.A2760 0.002 break,anti,~C3'-endo,non-stack,non-pair-contact,ss-non-loop 1054 A . A.A2792 0.003 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop 1055 C . A.C2793 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,ss-non-loop 1056 C . A.C2794 0.004 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop 1057 U ) A.U2795 0.005 anti,~C3'-endo,BI,canonical,helix,stem-end,coaxial-stack,phosphate 1058 G ) A.G2796 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1059 C ) A.C2797 0.013 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1060 A ) A.A2798 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 1061 U ) A.U2799 0.012 anti,~C3'-endo,BI,isolated-canonical,non-canonical,non-pair-contact,helix,bulge 1062 U . A.U2800 0.007 anti,~C3'-endo,BI,non-pair-contact,bulge 1063 A ) A.A2801 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 1064 A ) A.A2802 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 1065 A ) A.A2803 0.005 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 1066 A ) A.A2804 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1067 A ) A.A2805 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1068 U ) A.U2806 0.004 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 1069 U ) A.U2807 0.005 anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet 1070 U . A.U2808 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,ss-non-loop,cap-donor 1071 C . A.C2809 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,ss-non-loop,splayed-apart 1072 G ( A.G2810 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,splayed-apart 1073 G ( A.G2811 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1074 U ( A.U2812 0.003 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,hairpin-loop,kissing-loop,phosphate 1075 U . A.U2813 0.005 anti,~C2'-endo,BI,non-pair-contact,hairpin-loop,kissing-loop,cap-acceptor,splayed-apart 1076 G . A.G2814 0.004 turn,syn,~C2'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,kissing-loop,phosphate,splayed-apart 1077 G . A.G2815 0.005 anti,~C3'-endo,non-pair-contact,hairpin-loop,kissing-loop,splayed-apart 1078 G . A.G2816 0.008 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,kissing-loop,cap-donor,phosphate 1079 G . A.G2817 0.006 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,kissing-loop,phosphate 1080 C . A.C2818 0.004 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,kissing-loop 1081 G [ A.G2819 0.005 pseudoknotted,anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix-end,hairpin-loop,kissing-loop 1082 A ) A.A2820 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop,kissing-loop 1083 C ) A.C2821 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,hairpin-loop 1084 C ) A.C2822 0.014 anti,~C2'-endo,canonical,non-pair-contact,helix-end,stem-end,hairpin-loop,splayed-apart 1085 U ( A.U2823 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop,cap-donor,phosphate,splayed-apart 1086 C ( A.C2824 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,multiplet,hairpin-loop,A-minor 1087 G ( A.G2825 0.004 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,multiplet,hairpin-loop,A-minor,phosphate 1088 G ( A.G2826 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,hairpin-loop,phosphate 1089 A ( A.A2827 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,hairpin-loop,phosphate 1090 G ( A.G2828 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop,kissing-loop 1091 C . A.C2829 0.002 anti,~C3'-endo,non-canonical,non-pair-contact,helix,hairpin-loop,kissing-loop,phosphate 1092 A . A.A2830 0.011 anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,kissing-loop,phosphate,splayed-apart 1093 G . A.G2831 0.003 anti,~C2'-endo,non-pair-contact,hairpin-loop,kissing-loop,splayed-apart 1094 A . A.A2832 0.004 syn,~C2'-endo,non-canonical,non-pair-contact,hairpin-loop,kissing-loop,splayed-apart 1095 A . A.A2833 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop,kissing-loop,phosphate,splayed-apart 1096 C . A.C2834 0.005 anti,~C3'-endo,non-pair-contact,hairpin-loop,kissing-loop 1097 C . A.C2835 0.003 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,kissing-loop,phosphate 1098 C . A.C2836 0.003 anti,~C3'-endo,BII,non-pair-contact,hairpin-loop,ribose-zipper,kissing-loop,phosphate 1099 A . A.A2837 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,A-minor,ribose-zipper,kissing-loop,cap-acceptor,phosphate 1100 A . A.A2838 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,helix,hairpin-loop,A-minor,kissing-loop,splayed-apart 1101 C ] A.C2839 0.006 pseudoknotted,turn,anti,~C2'-endo,non-stack,isolated-canonical,non-pair-contact,helix-end,hairpin-loop,kissing-loop,splayed-apart 1102 C ) A.C2840 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop,kissing-loop,phosphate,splayed-apart 1103 U ) A.U2841 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 1104 C ) A.C2842 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 1105 C ) A.C2843 0.008 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,multiplet,A-minor 1106 G ) A.G2844 0.006 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,multiplet,A-minor 1107 A ) A.A2845 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end 1108 G ( A.G2846 0.011 turn,anti,isolated-canonical,non-pair-contact,helix,junction-loop,splayed-apart 1109 C . A.C2847 0.003 anti,~C3'-endo,BI,non-pair-contact,junction-loop,splayed-apart 1110 A ( A.A2848 0.004 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,junction-loop 1111 G ( A.G2849 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,phosphate 1112 U . A.U2850 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,ss-non-loop 1113 A . A.A2851 0.004 syn,~C3'-endo,BI,non-pair-contact,ss-non-loop 1114 C . A.C2852 0.005 syn,~C2'-endo,non-pair-contact,ss-non-loop,splayed-apart 1115 A . A.A2853 0.002 turn,anti,non-pair-contact,ss-non-loop,phosphate,splayed-apart 1116 U . A.U2854 0.015 turn,syn,~C2'-endo,non-stack,non-canonical,non-pair-contact,helix-end,ss-non-loop,phosphate,splayed-apart 1117 G ( A.G2855 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,phosphate,splayed-apart 1118 C ( A.C2856 0.009 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 1119 U . A.U2857 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 1120 A . A.A2858 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate 1121 A . A.A2859 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate 1122 G ( A.G2860 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 1123 A ( A.A2861 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1124 C ( A.C2862 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop 1125 U . A.U2863 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,splayed-apart 1126 U . A.U2864 0.002 turn,anti,~C2'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart 1127 C . A.C2865 0.011 syn,~C2'-endo,non-stack,non-pair-contact,hairpin-loop,splayed-apart 1128 A . A.A2866 0.004 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,phosphate,splayed-apart 1129 C [ A.C2867 0.005 pseudoknotted,anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,hairpin-loop,phosphate 1130 C . A.C2868 0.003 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,phosphate 1131 A . A.A2869 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate 1132 G ) A.G2870 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,phosphate 1133 U ) A.U2871 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1134 C ) A.C2872 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 1135 A . A.A2873 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 1136 A . A.A2874 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 1137 A . A.A2875 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 1138 G ) A.G2876 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 1139 C ) A.C2877 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack 1140 G . A.G2878 0.002 anti,~C3'-endo,non-pair-contact,ss-non-loop 1141 A . A.A2879 0.003 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop 1142 A . A.A2880 0.003 syn,~C3'-endo,BI,non-pair-contact,ss-non-loop 1143 C . A.C2881 0.002 break,anti,~C3'-endo,non-pair-contact,ss-non-loop 1144 C ) A.C2889 0.009 anti,~C3'-endo,BI,non-stack,canonical,helix,stem-end,phosphate 1145 U ) A.U2890 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop 1146 C . A.C2891 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,junction-loop,splayed-apart 1147 A . A.A2892 0.002 anti,~C2'-endo,BI,non-canonical,non-pair-contact,multiplet,junction-loop,A-minor,splayed-apart 1148 A . A.A2893 0.006 anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,A-minor 1149 U . A.U2894 0.006 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,junction-loop,splayed-apart 1150 U . A.U2895 0.007 anti,~C3'-endo,BI,non-stack,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,phosphate,splayed-apart 1151 G . A.G2896 0.006 anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,phosphate 1152 A . A.A2897 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop,phosphate 1153 U . A.U2898 0.002 syn,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop,phosphate 1154 C . A.C2899 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop,phosphate 1155 C ( A.C2900 0.006 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,junction-loop 1156 A ( A.A2901 0.004 anti,~C3'-endo,canonical,non-pair-contact,helix,stem 1157 A ( A.A2902 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop 1158 U . A.U2903 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor,splayed-apart 1159 A . A.A2904 0.005 turn,anti,~C3'-endo,non-pair-contact,hairpin-loop,splayed-apart 1160 A . A.A2905 0.002 anti,~C3'-endo,non-pair-contact,hairpin-loop,cap-donor,phosphate 1161 C . A.C2906 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate 1162 U ) A.U2907 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop 1163 U ) A.U2908 0.003 anti,~C3'-endo,BI,non-stack,canonical,helix,stem,phosphate 1164 G ) A.G2909 0.006 anti,~C3'-endo,BII,canonical,non-pair-contact,helix,stem-end,junction-loop,phosphate 1165 A . A.A2910 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,helix,junction-loop,phosphate,splayed-apart 1166 C . A.C2911 0.002 turn,anti,~C2'-endo,non-pair-contact,junction-loop,cap-donor,splayed-apart 1167 C . A.C2912 0.004 turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix,junction-loop,phosphate,splayed-apart 1168 A . A.A2913 0.007 turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,cap-donor,cap-acceptor,phosphate,splayed-apart 1169 A . A.A2914 0.003 turn,anti,~C2'-endo,non-pair-contact,junction-loop,splayed-apart 1170 C ) A.C2915 0.007 anti,~C3'-endo,BII,isolated-canonical,non-pair-contact,helix,junction-loop,cap-acceptor,phosphate,splayed-apart 1171 G ] A.G2916 0.004 pseudoknotted,turn,anti,~C3'-endo,isolated-canonical,non-pair-contact,cap-donor,cap-acceptor,splayed-apart 1172 G . A.G2917 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,ss-non-loop,cap-acceptor,phosphate,splayed-apart 1173 A . A.A2918 0.005 turn,non-canonical,non-pair-contact,ss-non-loop,phosphate,splayed-apart 1174 A . A.A2919 0.003 turn,anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,phosphate,splayed-apart 1175 C . A.C2920 0.004 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop 1176 A . A.A2921 0.004 ~C2'-endo,non-canonical,non-pair-contact,multiplet,ss-non-loop,cap-acceptor 1177 A ) A.A2922 0.006 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,phosphate 1178 G ) A.G2923 0.006 anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,phosphate 1179 U ) A.U2924 0.008 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 1180 U ) A.U2925 0.006 anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,splayed-apart 1181 A . A.A2926 0.004 turn,anti,BII,non-stack,non-pair-contact,bulge,cap-acceptor,splayed-apart 1182 C . A.C2927 0.011 turn,anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,bulge,cap-acceptor,phosphate,splayed-apart 1183 C ) A.C2928 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,cap-donor,phosphate 1184 C ) A.C2929 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,A-minor,ribose-zipper 1185 U ) A.U2930 0.002 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,A-minor,ribose-zipper 1186 A ) A.A2931 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1187 G ) A.G2932 0.012 anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,phosphate 1188 G ) A.G2933 0.019 anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop 1189 G . A.G2934 0.006 turn,u-turn,anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,splayed-apart 1190 A . A.A2935 0.002 turn,u-turn,anti,~C2'-endo,non-pair-contact,junction-loop,phosphate,splayed-apart 1191 U . A.U2936 0.010 u-turn,anti,non-stack,non-canonical,multiplet,junction-loop 1192 A . A.A2937 0.005 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,junction-loop,cap-donor,phosphate 1193 A . A.A2938 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,junction-loop,phosphate 1194 C . A.C2939 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,junction-loop 1195 A . A.A2940 0.008 anti,~C3'-endo,non-canonical,non-pair-contact,helix,junction-loop 1196 G ( A.G2941 0.009 anti,~C3'-endo,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,bulge,junction-loop 1197 C ( A.C2942 0.013 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,A-minor 1198 G ( A.G2943 0.008 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,A-minor,ribose-zipper,phosphate 1199 C . A.C2944 0.006 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,ribose-zipper 1200 A . A.A2945 0.009 anti,~C2'-endo,BII,non-canonical,non-pair-contact,multiplet,internal-loop,phosphate 1201 A ( A.A2946 0.005 anti,~C3'-endo,BI,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,internal-loop,cap-donor 1202 U . A.U2947 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop 1203 C ( A.C2948 0.005 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop 1204 C ( A.C2949 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,A-minor 1205 U ( A.U2950 0.003 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 1206 A ( A.A2951 0.003 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 1207 U ( A.U2952 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1208 U ( A.U2953 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 1209 C . A.C2954 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,A-minor 1210 U ( A.U2955 0.009 anti,~C2'-endo,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,bulge,internal-loop,A-minor,phosphate 1211 A . A.A2956 0.002 anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,bulge,A-minor,cap-acceptor,phosphate 1212 G ( A.G2957 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,cap-donor 1213 A ( A.A2958 0.003 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,phosphate 1214 G . A.G2959 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,helix,hairpin-loop 1215 U . A.U2960 0.006 turn,anti,~C3'-endo,BI,non-stack,non-pair-contact,hairpin-loop,phosphate 1216 C . A.C2961 0.004 anti,BI,non-pair-contact,hairpin-loop,phosphate 1217 C . A.C2962 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,splayed-apart 1218 A . A.A2963 0.004 anti,~C3'-endo,non-pair-contact,hairpin-loop,splayed-apart 1219 U . A.U2964 0.004 anti,~C3'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart 1220 A . A.A2965 0.002 turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop,cap-acceptor,phosphate,splayed-apart 1221 U ) A.U2966 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,cap-donor,phosphate 1222 C ) A.C2967 0.008 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 1223 A ) A.A2968 0.002 anti,~C3'-endo,BI,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,bulge,internal-loop,A-minor 1224 A . A.A2969 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,internal-loop,A-minor 1225 C . A.C2970 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,A-minor 1226 A ) A.A2971 0.003 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 1227 A ) A.A2972 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1228 U ) A.U2973 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 1229 A ) A.A2974 0.003 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 1230 G ) A.G2975 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,A-minor 1231 G ) A.G2976 0.005 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop 1232 G . A.G2977 0.007 anti,~C2'-endo,BII,non-canonical,non-pair-contact,multiplet,internal-loop 1233 U . A.U2978 0.006 anti,~C3'-endo,non-stack,non-canonical,non-pair-contact,multiplet,internal-loop 1234 U . A.U2979 0.006 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,internal-loop 1235 U ) A.U2980 0.004 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,multiplet,internal-loop 1236 A . A.A2981 0.005 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop 1237 C ) A.C2982 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,A-minor 1238 G ) A.G2983 0.014 anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,A-minor,phosphate 1239 A . A.A2984 0.005 anti,~C2'-endo,non-pair-contact,bulge,cap-acceptor,phosphate 1240 C ) A.C2985 0.011 anti,~C3'-endo,isolated-canonical,non-pair-contact,helix,multiplet,bulge,junction-loop 1241 C . A.C2986 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop,phosphate 1242 U . A.U2987 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,phosphate 1243 C . A.C2988 0.004 turn,anti,non-canonical,non-pair-contact,helix,multiplet,junction-loop,splayed-apart 1244 G . A.G2989 0.002 turn,anti,~C3'-endo,non-pair-contact,junction-loop,cap-acceptor,phosphate,splayed-apart 1245 A . A.A2990 0.011 syn,~C2'-endo,non-pair-contact,junction-loop,phosphate,splayed-apart 1246 U . A.U2991 0.009 turn,anti,~C2'-endo,BI,non-stack,non-canonical,non-pair-contact,helix,multiplet,junction-loop,phosphate,splayed-apart 1247 G . A.G2992 0.005 anti,~C3'-endo,BI,non-pair-contact,junction-loop,splayed-apart 1248 U . A.U2993 0.013 anti,~C2'-endo,BII,non-canonical,non-pair-contact,multiplet,junction-loop,phosphate,splayed-apart 1249 U ( A.U2994 0.004 anti,~C3'-endo,isolated-canonical,non-canonical,non-pair-contact,helix-end,multiplet,bulge,junction-loop,splayed-apart 1250 G ( A.G2995 0.017 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,phosphate 1251 G ( A.G2996 0.013 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1252 A ( A.A2997 0.004 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop 1253 U . A.U2998 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 1254 C ( A.C2999 0.017 anti,~C3'-endo,isolated-canonical,non-pair-contact,helix,bulge,internal-loop,phosphate 1255 A ( A.A3000 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 1256 G ( A.G3001 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1257 G ( A.G3002 0.002 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 1258 A ( A.A3003 0.004 anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 1259 C ( A.C3004 0.015 anti,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,splayed-apart 1260 A . A.A3005 0.009 turn,syn,~C2'-endo,non-pair-contact,junction-loop,phosphate,splayed-apart 1261 U . A.U3006 0.009 anti,~C2'-endo,BII,non-canonical,non-pair-contact,multiplet,junction-loop,splayed-apart 1262 C ( A.C3007 0.004 turn,anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor 1263 C ( A.C3008 0.005 anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,A-minor 1264 C . A.C3009 0.007 syn,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop 1265 G ( A.G3010 0.012 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 1266 A ( A.A3011 0.004 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 1267 U ( A.U3012 0.003 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 1268 G ( A.G3013 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1269 G ( A.G3014 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1270 U ( A.U3015 0.007 anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop,phosphate,splayed-apart 1271 G . A.G3016 0.006 turn,anti,non-canonical,non-pair-contact,helix-end,hairpin-loop,splayed-apart 1272 C . A.C3017 0.003 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,phosphate,splayed-apart 1273 A . A.A3018 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor,splayed-apart 1274 G . A.G3019 0.005 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,phosphate 1275 C . A.C3020 0.008 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,phosphate 1276 C . A.C3021 0.004 anti,~C3'-endo,non-pair-contact,hairpin-loop 1277 G ) A.G3022 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop 1278 C ) A.C3023 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1279 U ) A.U3024 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1280 A ) A.A3025 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1281 U ) A.U3026 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1282 U ) A.U3027 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 1283 A . A.A3028 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop 1284 A . A.A3029 0.006 turn,anti,~C2'-endo,BII,non-canonical,non-pair-contact,multiplet,internal-loop 1285 A . A.A3030 0.005 anti,~C3'-endo,non-pair-contact,internal-loop 1286 G ) A.G3031 0.007 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,A-minor 1287 G ) A.G3032 0.006 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor 1288 U . A.U3033 0.005 anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,splayed-apart 1289 U ( A.U3034 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop,phosphate,splayed-apart 1290 C ( A.C3035 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,multiplet,A-minor 1291 G ( A.G3036 0.007 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,multiplet,A-minor,phosphate 1292 U ( A.U3037 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,cap-donor,phosphate 1293 U ( A.U3038 0.006 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,hairpin-loop,phosphate 1294 U . A.U3039 0.007 anti,~C3'-endo,non-canonical,non-pair-contact,hairpin-loop,cap-acceptor 1295 G . A.G3040 0.003 turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,cap-acceptor,phosphate 1296 U . A.U3041 0.004 anti,~C3'-endo,non-pair-contact,hairpin-loop,cap-donor,phosphate 1297 U . A.U3042 0.004 anti,~C3'-endo,non-pair-contact,hairpin-loop,cap-acceptor,phosphate 1298 C . A.C3043 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-donor 1299 A ) A.A3044 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop 1300 A ) A.A3045 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1301 C ) A.C3046 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,multiplet,A-minor,ribose-zipper 1302 G ) A.G3047 0.005 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,multiplet,A-minor,ribose-zipper 1303 A ) A.A3048 0.004 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,junction-loop,cap-acceptor 1304 U . A.U3049 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop,cap-donor,phosphate 1305 U . A.U3050 0.008 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,splayed-apart 1306 A . A.A3051 0.018 turn,u-turn,anti,~C2'-endo,BI,non-canonical,non-pair-contact,multiplet,junction-loop,A-minor,phosphate,splayed-apart 1307 A . A.A3052 0.003 u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,A-minor 1308 A . A.A3053 0.004 turn,u-turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix,junction-loop,phosphate,splayed-apart 1309 G ) A.G3054 0.009 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,phosphate,splayed-apart 1310 U ) A.U3055 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 1311 C ) A.C3056 0.005 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 1312 C ) A.C3057 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,cap-donor,phosphate 1313 U ) A.U3058 0.004 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,cap-acceptor,splayed-apart 1314 A . A.A3059 0.005 turn,anti,~C2'-endo,non-pair-contact,bulge,phosphate,splayed-apart 1315 C . A.C3060 0.004 turn,anti,~C2'-endo,non-stack,non-pair-contact,bulge,phosphate,splayed-apart 1316 G ) A.G3061 0.010 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,bulge,internal-loop,cap-donor,phosphate,splayed-apart 1317 U . A.U3062 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate,splayed-apart 1318 G . A.G3063 0.006 syn,non-pair-contact,internal-loop,phosphate,splayed-apart 1319 A . A.A3064 0.006 turn,anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,internal-loop,phosphate,splayed-apart 1320 U ) A.U3065 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,phosphate,splayed-apart 1321 C ) A.C3066 0.014 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1322 U ) A.U3067 0.008 anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,phosphate 1323 G . A.G3068 0.006 syn,non-pair-contact,bulge,phosphate 1324 A ) A.A3069 0.006 turn,anti,~C3'-endo,isolated-canonical,non-canonical,non-pair-contact,helix-end,multiplet,bulge,junction-loop,cap-donor 1325 G . A.G3070 0.007 anti,~C3'-endo,non-pair-contact,junction-loop,cap-donor 1326 U . A.U3071 0.004 anti,~C3'-endo,BI,non-pair-contact,junction-loop 1327 U . A.U3072 0.008 anti,~C3'-endo,non-stack,non-pair-contact,junction-loop 1328 C . A.C3073 0.007 anti,~C3'-endo,BI,non-stack,non-canonical,non-pair-contact,helix-end,junction-loop,cap-donor 1329 A . A.A3074 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,helix,junction-loop,phosphate 1330 G ( A.G3075 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,A-minor,phosphate 1331 A ( A.A3076 0.006 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1332 C ( A.C3077 0.018 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 1333 C ( A.C3078 0.015 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 1334 G ( A.G3079 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,A-minor 1335 G ( A.G3080 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1336 A ( A.A3081 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop 1337 G . A.G3082 0.006 u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,cap-acceptor 1338 U . A.U3083 0.007 turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 1339 A . A.A3084 0.007 u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-donor,phosphate 1340 A . A.A3085 0.005 u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,A-minor,phosphate 1341 U ) A.U3086 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop 1342 C ) A.C3087 0.015 anti,~C3'-endo,BI,non-stack,canonical,helix,stem,coaxial-stack 1343 C ) A.C3088 0.016 anti,~C2'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,A-minor,splayed-apart 1344 A . A.A3089 0.002 turn,syn,~C3'-endo,non-stack,bulge,splayed-apart 1345 G ) A.G3090 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,splayed-apart 1346 G ) A.G3091 0.013 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1347 U ) A.U3092 0.005 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 1348 C ) A.C3093 0.005 anti,~C3'-endo,non-stack,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,A-minor,phosphate 1349 G . A.G3094 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,helix,junction-loop,ribose-zipper 1350 G . A.G3095 0.005 anti,~C3'-endo,non-canonical,non-pair-contact,helix,junction-loop,ribose-zipper,splayed-apart 1351 U } A.U3096 0.003 pseudoknotted,anti,~C2'-endo,isolated-canonical,non-pair-contact,junction-loop,cap-acceptor,splayed-apart 1352 U . A.U3097 0.005 turn,anti,~C2'-endo,non-pair-contact,junction-loop,splayed-apart 1353 U ) A.U3098 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,junction-loop,cap-donor,phosphate,splayed-apart 1354 C ) A.C3099 0.004 anti,~C3'-endo,BII,canonical,non-pair-contact,helix-end,stem-end,internal-loop,splayed-apart 1355 U . A.U3100 0.007 turn,anti,~C2'-endo,non-stack,non-canonical,non-pair-contact,multiplet,internal-loop,splayed-apart 1356 A . A.A3101 0.005 anti,~C2'-endo,BII,non-canonical,non-pair-contact,multiplet,internal-loop,splayed-apart 1357 U ) A.U3102 0.006 anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,multiplet,internal-loop,phosphate 1358 C ) A.C3103 0.008 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,phosphate 1359 U ) A.U3104 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop 1360 A . A.A3105 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate 1361 C ) A.C3106 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 1362 U ) A.U3107 0.004 anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,phosphate,splayed-apart 1363 U . A.U3108 0.006 anti,~C3'-endo,non-stack,ss-non-loop,phosphate,splayed-apart 1364 U . A.U3109 0.003 break,anti,~C2'-endo,non-stack,ss-non-loop,splayed-apart 1365 A ( A.A3113 0.003 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack 1366 U ( A.U3114 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1367 U ( A.U3115 0.003 anti,~C3'-endo,BI,non-stack,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 1368 C . A.C3116 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 1369 C ( A.C3117 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 1370 U ( A.U3118 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1371 C ( A.C3119 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 1372 C . A.C3120 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 1373 C . A.C3121 0.005 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate 1374 U . A.U3122 0.010 syn,~C2'-endo,BII,non-pair-contact,internal-loop 1375 G . A.G3123 0.003 turn,anti,non-stack,non-pair-contact,internal-loop 1376 U . A.U3124 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 1377 A . A.A3125 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 1378 C ( A.C3126 0.004 anti,~C3'-endo,BI,isolated-canonical,non-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,internal-loop,A-minor 1379 G . A.G3127 0.016 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,splayed-apart 1380 A . A.A3128 0.004 turn,anti,~C2'-endo,BI,non-pair-contact,hairpin-loop,splayed-apart 1381 A . A.A3129 0.007 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 1382 A . A.A3130 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,hairpin-loop 1383 G ) A.G3131 0.003 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix-end,multiplet,hairpin-loop,internal-loop,A-minor 1384 G . A.G3132 0.009 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 1385 A . A.A3133 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate 1386 C . A.C3134 0.004 syn,~C3'-endo,non-pair-contact,internal-loop 1387 A . A.A3135 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop 1388 A . A.A3136 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 1389 G ) A.G3137 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 1390 A ) A.A3138 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1391 G ) A.G3139 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 1392 A . A.A3140 0.005 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop 1393 A ) A.A3141 0.005 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 1394 A ) A.A3142 0.005 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 1395 U ) A.U3143 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack 1396 A ( A.A3144 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack 1397 A ( A.A3145 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1398 G ( A.G3146 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1399 G ( A.G3147 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1400 C ( A.C3148 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,A-minor,phosphate 1401 C . A.C3149 0.020 anti,~C2'-endo,BII,non-stack,non-canonical,non-pair-contact,multiplet,internal-loop 1402 U . A.U3150 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,internal-loop 1403 A . A.A3151 0.004 syn,~C3'-endo,non-canonical,non-pair-contact,multiplet,internal-loop,A-minor,phosphate 1404 C ( A.C3152 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,phosphate 1405 U ( A.U3153 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1406 U ( A.U3154 0.008 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,cap-acceptor,phosphate 1407 C . A.C3155 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-donor,phosphate 1408 A . A.A3156 0.005 anti,~C2'-endo,non-stack,non-pair-contact,hairpin-loop,splayed-apart 1409 C . A.C3157 0.004 turn,anti,~C3'-endo,non-stack,non-pair-contact,hairpin-loop,phosphate,splayed-apart 1410 A . A.A3158 0.003 syn,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,splayed-apart 1411 A ) A.A3159 0.003 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop 1412 A ) A.A3160 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 1413 G ) A.G3161 0.008 anti,~C2'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop 1414 C . A.C3162 0.001 turn,anti,~C2'-endo,BI,non-pair-contact,internal-loop,cap-donor,phosphate 1415 G ) A.G3163 0.012 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop,A-minor 1416 C ) A.C3164 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1417 C ) A.C3165 0.008 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 1418 U ) A.U3166 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1419 U ) A.U3167 0.003 anti,~C3'-endo,BII,canonical,non-pair-contact,helix,stem-end,coaxial-stack,splayed-apart 1420 C . A.C3168 0.004 anti,~C3'-endo,non-pair-contact,ss-non-loop,splayed-apart 1421 C . A.C3169 0.005 syn,BI,non-pair-contact,ss-non-loop,phosphate 1422 C . A.C3170 0.003 syn,~C3'-endo,non-pair-contact,ss-non-loop 1423 C . A.C3171 0.003 anti,~C3'-endo,BII,non-pair-contact,ss-non-loop,splayed-apart 1424 C . A.C3172 0.008 anti,~C2'-endo,non-pair-contact,ss-non-loop,phosphate,splayed-apart 1425 G . A.G3173 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,ss-non-loop,phosphate 1426 U ( A.U3174 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,phosphate 1427 A ( A.A3175 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 1428 A ( A.A3176 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop,phosphate 1429 A . A.A3177 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,helix,hairpin-loop 1430 U . A.U3178 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop 1431 G . A.G3179 0.002 anti,~C3'-endo,non-canonical,non-pair-contact,helix,hairpin-loop 1432 A . A.A3180 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop 1433 U . A.U3181 0.002 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate 1434 A . A.A3182 0.011 anti,~C2'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart 1435 U . A.U3183 0.003 turn,anti,~C2'-endo,hairpin-loop,splayed-apart 1436 C . A.C3184 0.003 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,splayed-apart 1437 A . A.A3185 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop 1438 U . A.U3186 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,helix,hairpin-loop,phosphate,splayed-apart 1439 C . A.C3187 0.006 turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,splayed-apart 1440 U . A.U3188 0.005 anti,~C2'-endo,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop,phosphate,splayed-apart 1441 C . A.C3189 0.005 turn,anti,~C3'-endo,hairpin-loop,phosphate,splayed-apart 1442 A . A.A3190 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop,phosphate,splayed-apart 1443 A . A.A3191 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,hairpin-loop 1444 C . A.C3192 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop 1445 U ) A.U3193 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop 1446 U ) A.U3194 0.003 anti,~C3'-endo,canonical,non-pair-contact,helix,stem 1447 A ) A.A3195 0.005 turn,anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,phosphate 1448 G . A.G3196 0.007 break,syn,~C2'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop 1449 A . A.A3201 0.005 ~C2'-endo,non-pair-contact,ss-non-loop 1450 U . A.U3202 0.004 anti,~C3'-endo,BI,non-pair-contact,ss-non-loop 1451 A . A.A3203 0.002 anti,~C3'-endo,non-pair-contact,ss-non-loop,phosphate 1452 C . A.C3204 0.003 syn,~C3'-endo,non-pair-contact,ss-non-loop,phosphate 1453 C . A.C3205 0.003 anti,~C3'-endo,non-pair-contact,ss-non-loop,phosphate 1454 C . A.C3206 0.004 syn,~C3'-endo,non-pair-contact,ss-non-loop,phosphate,splayed-apart 1455 A . A.A3207 0.002 break,anti,~C3'-endo,non-stack,ss-non-loop,splayed-apart 1456 C . A.C3212 0.004 syn,~C3'-endo,non-pair-contact,ss-non-loop 1457 A ( A.A3213 0.006 anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end 1458 C ( A.C3214 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 1459 C ( A.C3215 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1460 C ( A.C3216 0.004 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,hairpin-loop,splayed-apart 1461 A . A.A3217 0.004 turn,anti,~C3'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart 1462 A . A.A3218 0.002 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate,splayed-apart 1463 G . A.G3219 0.003 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,phosphate,splayed-apart 1464 A . A.A3220 0.005 turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,hairpin-loop,cap-donor,phosphate,splayed-apart 1465 A . A.A3221 0.002 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,phosphate 1466 C . A.C3222 0.006 anti,~C3'-endo,non-pair-contact,hairpin-loop 1467 A . A.A3223 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop 1468 G ) A.G3224 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop 1469 G ) A.G3225 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 1470 G ) A.G3226 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,phosphate 1471 U ) A.U3227 0.004 anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,phosphate,splayed-apart 1472 U . A.U3228 0.004 non-stack,ss-non-loop,phosphate,splayed-apart 1473 C ( B.C1601 0.005 break,anti,~C3'-endo,non-stack,isolated-canonical,non-pair-contact,helix-end 1474 A ( B.A1603 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack 1475 G ( B.G1604 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1476 A ( B.A1605 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1477 G ( B.G1606 0.010 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 1478 U ( B.U1607 0.010 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 1479 G ( B.G1608 0.008 anti,canonical,non-pair-contact,helix,stem-end,coaxial-stack,phosphate,splayed-apart 1480 U . B.U1609 0.006 anti,~C3'-endo,BI,non-stack,non-pair-contact,ss-non-loop,splayed-apart 1481 A . B.A1610 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,ss-non-loop 1482 G ( B.G1611 0.010 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet 1483 C ( B.C1612 0.006 anti,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet 1484 U ( B.U1613 0.003 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,splayed-apart 1485 U . B.U1614 0.004 turn,anti,~C3'-endo,non-stack,non-pair-contact,ss-non-loop,phosphate,splayed-apart 1486 A . B.A1615 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,ss-non-loop,phosphate,splayed-apart 1487 A . B.A1616 0.002 break,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop 1488 A . B.A1621 0.002 anti,~C3'-endo,non-canonical,non-pair-contact,helix,ss-non-loop,phosphate 1489 A ) B.A1622 0.004 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,phosphate 1490 G ) B.G1623 0.006 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,phosphate 1491 C ) B.C1624 0.005 anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet 1492 A . B.A1625 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,helix,ss-non-loop 1493 C ( B.C1626 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack 1494 C ( B.C1627 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 1495 C . B.C1628 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop 1496 A ( B.A1629 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 1497 A ( B.A1630 0.003 anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop 1498 C . B.C1631 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,helix,hairpin-loop 1499 U . B.U1632 0.003 u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor 1500 U . B.U1633 0.005 turn,u-turn,anti,~C3'-endo,non-pair-contact,hairpin-loop 1501 A . B.A1634 0.003 u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-donor,phosphate 1502 C . B.C1635 0.003 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate 1503 A . B.A1636 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,hairpin-loop 1504 C . B.C1637 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop,phosphate 1505 U ) B.U1638 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop 1506 U ) B.U1639 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 1507 A . B.A1640 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate 1508 G ) B.G1641 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate 1509 G ) B.G1642 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack 1510 A . B.A1643 0.004 anti,~C3'-endo,non-canonical,non-pair-contact,helix,ss-non-loop 1511 G . B.G1644 0.001 anti,~C3'-endo,BII,non-canonical,non-pair-contact,multiplet,ss-non-loop 1512 A . B.A1645 0.002 anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,ss-non-loop 1513 U . B.U1646 0.003 break,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop,phosphate 1514 U ( B.U1648 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,phosphate 1515 C ( B.C1649 0.003 anti,~C3'-endo,BI,non-stack,canonical,non-pair-contact,helix,stem,coaxial-stack 1516 A ( B.A1650 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1517 A ( B.A1651 0.002 break,anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack 1518 U ) B.U1658 0.003 anti,~C3'-endo,BI,non-stack,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack 1519 U ) B.U1659 0.003 anti,~C3'-endo,BI,non-stack,canonical,non-pair-contact,helix,stem,coaxial-stack 1520 G ) B.G1660 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1521 A ) B.A1661 0.003 break,anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,coaxial-stack 1522 C ) B.C1663 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,phosphate 1523 G ) B.G1664 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1524 C ) B.C1665 0.006 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 1525 U ) B.U1666 0.005 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 1526 C ) B.C1667 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 1527 U ) B.U1668 0.003 anti,~C3'-endo,non-stack,canonical,non-pair-contact,helix,stem-end,coaxial-stack 1528 G ) B.G1669 0.011 anti,~C3'-endo,isolated-canonical,non-pair-contact,helix-end,phosphate 1529 A . B.A1670 0.002 anti,~C3'-endo,non-pair-contact,ss-non-loop 1530 A . A.A3301 0.005 anti,non-canonical,non-pair-contact,helix,ss-non-loop **************************************************************************** List of 16 additional files 1 dssr-pairs.pdb -- an ensemble of base pairs 2 dssr-multiplets.pdb -- an ensemble of multiplets 3 dssr-stems.pdb -- an ensemble of stems 4 dssr-helices.pdb -- an ensemble of helices (coaxial stacking) 5 dssr-hairpins.pdb -- an ensemble of hairpin loops 6 dssr-bulges.pdb -- an ensemble of bulges 7 dssr-iloops.pdb -- an ensemble of internal loops 8 dssr-junctions.pdb -- an ensemble of junctions (multi-branch) 9 dssr-2ndstrs.bpseq -- secondary structure in bpseq format 10 dssr-2ndstrs.ct -- secondary structure in connectivity table format 11 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation 12 dssr-torsions.txt -- backbone torsion angles and suite names 13 dssr-splays.pdb -- an ensemble of splayed-apart units 14 dssr-Aminors.pdb -- an ensemble of A minor motifs (types I and II) 15 dssr-stacks.pdb -- an ensemble of base stacks 16 dssr-atom2bases.pdb -- an ensemble of atom-base stacking interactions